scholarly journals Studies on diversity of soil microfungi in the Hornsund area, Spitsbergen

2013 ◽  
Vol 34 (1) ◽  
pp. 39-54 ◽  
Author(s):  
Siti Hafizah Hafizah ◽  
Siti Aisyah Alias ◽  
Hii Yii Siang ◽  
Jerzy Smykla ◽  
Ka−Lai Pang ◽  
...  
Keyword(s):  
Sequence Data ◽  
Intergenic Spacer ◽  
High Arctic ◽  
Soil Samples ◽  
Potato Dextrose Agar ◽  
Species Level ◽  
Thermal Growth ◽  
Geomyces Pannorum ◽  
Soil Microfungi

Abstract We assessed culturable soil microfungal diversity in various habitats around Hornsund, Spitsbergen in the High Arctic, using potato dextrose agar (PDA) medium. Thermal growth classification of the fungi obtained was determined by incubating them in 4°C and 25°C, permitting separation of those with psychrophilic, psychrotolerant and mesophilic char− acteristics. In total, 68 fungal isolates were obtained from 12 soil samples, and grouped into 38 mycelial morphotypes. Intergenic spacer regions of these morphotypes were sequenced, and they represented 25 distinct taxonomic units, of which 21 showed sufficient similarity with available sequence data in NCBI to be identified to species level. Soil under ornithogenic influence showed the highest species diversity, including sequences assigned to Mortierella macrocystis, M. elongata, Mortierella sp., Cudoniella sp., Varicosporium elodeae, Beauveria bassiana, Geomyces pannorum, Penicillium sp. and Atradidymella muscivora. Fourteen taxa were classified as psychrophilic, seven mesophilic, and four psychrotolerant.

An expanded phylogenetic analysis of Austrostipa (Poaceae: Stipeae) to test infrageneric relationships

2012 ◽  
Vol 25 (1) ◽  
pp. 1 ◽  
Author(s):  
Anna E. Syme ◽  
Daniel J. Murphy ◽  
Gareth D. Holmes ◽  
Stuart Gardner ◽  
Rachael Fowler ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Sequence Data ◽  
Strong Support ◽  
Molecular Data ◽  
Species Level ◽  
Internal Transcribed Spacer Region ◽  
Deep Coalescence ◽  
History Of ◽  
Levels Of Support

Although the Australasian grass genus Austrostipa is species rich, abundant and ecologically significant, the subgeneric classification of its 62 species has not been comprehensively tested with molecular data. We used three molecular markers from 51 species to determine a phylogeny of the genus and found strong support for the following seven of the existing subgenera: Falcatae, Austrostipa, Aulax, Lobatae, Bambusina, Lancea and Longiaristatae. The molecular data do not support Tuberculatae and Eremophilae, which could be combined with subgenus Austrostipa. The data are equivocal or insufficient regarding monophyly of Ceres, Arbuscula, Petaurista and Lanterna. Data from the nuclear internal transcribed spacer region appear to be suitable for phylogenetic analysis of this group, and the degree of sequence variability resolves species-level relationships with good levels of support. In contrast, chloroplast sequence data from the matK and rbcL genes do not resolve most relationships at the species level, and the inferred phylogeny hints at gene duplication, chloroplast capture, or deep coalescence in the evolutionary history of Austrostipa.

scholarly journals Extended phylogeny and a revised generic classification of thePannariaceae(Peltigerales, Ascomycota)

2014 ◽  
Vol 46 (5) ◽  
pp. 627-656 ◽  
Author(s):  
Stefan EKMAN ◽  
Mats WEDIN ◽  
Louise LINDBLOM ◽  
Per M. JØRGENSEN
Keyword(s):  
Data Model ◽  
Internal Transcribed Spacer ◽  
Nucleotide Diversity ◽  
Sequence Data ◽  
Species Level ◽  
Internal Transcribed Spacer Region ◽  
Original Sequence ◽  
Site Heterogeneity ◽  
Previously Treated

AbstractWe estimated phylogeny in the lichen-forming ascomycete familyPannariaceae. We specifically modelled spatial (across-site) heterogeneity in nucleotide frequencies, as models not incorporating this heterogeneity were found to be inadequate for our data. Model adequacy was measured here as the ability of the model to reconstruct nucleotide diversity per site in the original sequence data. A potential non-orthologue in the internal transcribed spacer region (ITS) ofDegelia plumbeawas observed. We propose a revised generic classification for thePannariaceae, accepting 30 genera, based on our phylogeny, previously published phylogenies, as well as available morphological and chemical data. Four genera are established as new:Austroparmeliella(for the ‘Parmeliella’laceratagroup), Nebularia(for the ‘Parmeliella’incrassatagroup),Nevesia(for ‘Fuscopannaria’sampaiana), andPectenia(for the ‘Degelia’plumbeagroup). Two genera are reduced to synonymy,Moelleropsis(included inFuscopannaria) andSantessoniella(non-monophyletic; type included inPsoroma).Lepidocollema, described as monotypic, is expanded to include 23 species, most of which have been treated in the ‘Parmeliella’marianagroup.HomotheciumandLeightoniella, previously treated in theCollemataceae, are here referred to thePannariaceae. We propose 41 new species-level combinations in the newly described and re-circumscribed genera mentioned above, as well as inLeciophysmaandPsoroma.

Section Mimadenia: its phylogenetic relationships within the genus Mimosa (Leguminosae, Mimosoideae) using plastid trnL - F sequence data

2011 ◽  
Vol 24 (2) ◽  
pp. 104 ◽  
Author(s):  
C. Bessega ◽  
R. H. Fortunato
Keyword(s):  
Phylogenetic Analysis ◽  
Phylogenetic Relationships ◽  
Sequence Data ◽  
Intergenic Spacer ◽  
Nucleotide Sequences ◽  
Trnl Intron ◽  
Infrageneric Classification ◽  
Morphological Group ◽  
Evolutionary Hypothesis

Mimosa L. includes more than 530 species and is subdivided into five sections, including Mimadenia Barneby, Batocaulon DC., Habbasia DC., Calothamnos Barneby and Mimosa. It has previously been proposed that Mimosa is derived from piptadenioid ancestors and that section Mimadenia is a morphological group intermediate between the piptadenoid ancestor and the remaining species from Mimosa. The main goals of the present study were to assess the monophyly of the genus Mimosa as it is currently described, including representatives of all five sections, test the previous evolutionary hypothesis that section Mimadenia is primitive within Mimosa and discuss the infrageneric classification from a phylogenetic view. We report a phylogenetic analysis of chloroplast nucleotide sequences of the trnL intron and the trnL–trnF intergenic spacer from 36 species of Mimosa, and six related genera. Our analysis indicated that genus Mimosa is monophyletic, and the species of section Mimadenia constitute a clade sister to the rest of the genus. Although section Mimadenia, as described by Barneby (1991), seems to be monophyletic, the remaining sections Barneby (1991) proposed are not resolved as monophyletic. An effort needs to be made towards a new infrageneric classification of Mimosa that considers the phylogenetic evidence.

K-MEANS CLUSTERING ALGORITHM BASED CLASSIFICATION OF SOIL FERTILITY IN NORTH WEST NIGERIA

2020 ◽  
Vol 4 (2) ◽  
pp. 780-787
Author(s):  
Ibrahim Hassan Hayatu ◽  
Abdullahi Mohammed ◽  
Barroon Ahmad Isma’eel ◽  
Sahabi Yusuf Ali
Keyword(s):  
Soil Fertility ◽  
Crop Yield ◽  
Clustering Algorithm ◽  
Soil Samples ◽  
North West ◽  
R Programming ◽  
Available Information ◽  
Northwest Region ◽  
The Relationship

Soil fertility determines a plant's development process that guarantees food sufficiency and the security of lives and properties through bumper harvests. The fertility of soil varies according to regions, thereby determining the type of crops to be planted. However, there is no repository or any source of information about the fertility of the soil in any region in Nigeria especially the Northwest of the country. The only available information is soil samples with their attributes which gives little or no information to the average farmer. This has affected crop yield in all the regions, more particularly the Northwest region, thus resulting in lower food production.  Therefore, this study is aimed at classifying soil data based on their fertility in the Northwest region of Nigeria using R programming. Data were obtained from the department of soil science from Ahmadu Bello University, Zaria. The data contain 400 soil samples containing 13 attributes. The relationship between soil attributes was observed based on the data. K-means clustering algorithm was employed in analyzing soil fertility clusters. Four clusters were identified with cluster 1 having the highest fertility, followed by 2 and the fertility decreases with an increasing number of clusters. The identification of the most fertile clusters will guide farmers on where best to concentrate on when planting their crops in order to improve productivity and crop yield.

scholarly journals Sequence data from isolated lichen-associated melanized fungi enhance delimitation of two new lineages within Chaetothyriomycetidae

2021 ◽  
Vol 20 (7) ◽  
pp. 911-927
Author(s):  
Lucia Muggia ◽  
Yu Quan ◽  
Cécile Gueidan ◽  
Abdullah M. S. Al-Hatmi ◽  
Martin Grube ◽  
...  
Keyword(s):  
Sequence Data ◽  
Single Species ◽  
Sister Group ◽  
Asexual Propagation ◽  
Dna Sequence Data ◽  
Wide Range ◽  
The Family ◽  
Rock Inhabiting Fungi ◽  
Stable Habitat

AbstractLichen thalli provide a long-lived and stable habitat for colonization by a wide range of microorganisms. Increased interest in these lichen-associated microbial communities has revealed an impressive diversity of fungi, including several novel lineages which still await formal taxonomic recognition. Among these, members of the Eurotiomycetes and Dothideomycetes usually occur asymptomatically in the lichen thalli, even if they share ancestry with fungi that may be parasitic on their host. Mycelia of the isolates are characterized by melanized cell walls and the fungi display exclusively asexual propagation. Their taxonomic placement requires, therefore, the use of DNA sequence data. Here, we consider recently published sequence data from lichen-associated fungi and characterize and formally describe two new, individually monophyletic lineages at family, genus, and species levels. The Pleostigmataceae fam. nov. and Melanina gen. nov. both comprise rock-inhabiting fungi that associate with epilithic, crust-forming lichens in subalpine habitats. The phylogenetic placement and the monophyly of Pleostigmataceae lack statistical support, but the family was resolved as sister to the order Verrucariales. This family comprises the species Pleostigma alpinum sp. nov., P. frigidum sp. nov., P. jungermannicola, and P. lichenophilum sp. nov. The placement of the genus Melanina is supported as a lineage within the Chaetothyriales. To date, this genus comprises the single species M. gunde-cimermaniae sp. nov. and forms a sister group to a large lineage including Herpotrichiellaceae, Chaetothyriaceae, Cyphellophoraceae, and Trichomeriaceae. The new phylogenetic analysis of the subclass Chaetothyiomycetidae provides new insight into genus and family level delimitation and classification of this ecologically diverse group of fungi.

scholarly journals First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 291-291 ◽  
Author(s):  
W. Ye ◽  
Y. Zeng ◽  
J. Kerns
Keyword(s):  
North Carolina ◽  
South Carolina ◽  
Sequence Data ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Body Width ◽  
Cervical Papilla ◽  
Stubby Root Nematode ◽  
Plant Parasitic

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

scholarly journals Whole genome characterization of strains belonging to the Ralstonia solanacearum species complex and in silico analysis of TaqMan assays for detection in this heterogenous species complex

2021 ◽  
Author(s):  
Viola Kurm ◽  
Ilse Houwers ◽  
Claudia E. Coipan ◽  
Peter Bonants ◽  
Cees Waalwijk ◽  
...  
Keyword(s):  
Ralstonia Solanacearum ◽  
In Silico ◽  
Species Complex ◽  
Sequence Data ◽  
In Silico Analysis ◽  
Whole Genome Sequence ◽  
Whole Genome ◽  
Genome Sequences ◽  
Pcr Assays

AbstractIdentification and classification of members of the Ralstonia solanacearum species complex (RSSC) is challenging due to the heterogeneity of this complex. Whole genome sequence data of 225 strains were used to classify strains based on average nucleotide identity (ANI) and multilocus sequence analysis (MLSA). Based on the ANI score (>95%), 191 out of 192(99.5%) RSSC strains could be grouped into the three species R. solanacearum, R. pseudosolanacearum, and R. syzygii, and into the four phylotypes within the RSSC (I,II, III, and IV). R. solanacearum phylotype II could be split in two groups (IIA and IIB), from which IIB clustered in three subgroups (IIBa, IIBb and IIBc). This division by ANI was in accordance with MLSA. The IIB subgroups found by ANI and MLSA also differed in the number of SNPs in the primer and probe sites of various assays. An in-silico analysis of eight TaqMan and 11 conventional PCR assays was performed using the whole genome sequences. Based on this analysis several cases of potential false positives or false negatives can be expected upon the use of these assays for their intended target organisms. Two TaqMan assays and two PCR assays targeting the 16S rDNA sequence should be able to detect all phylotypes of the RSSC. We conclude that the increasing availability of whole genome sequences is not only useful for classification of strains, but also shows potential for selection and evaluation of clade specific nucleic acid-based amplification methods within the RSSC.

Screening and Identification of Laccase Producing Fungi from Environmental Samples

2021 ◽  
Vol 6 (1) ◽  
pp. 91-98
Author(s):  
A. Bello ◽  
◽  
J. B. Ameh ◽  
D. A. Machido ◽  
A. I. Mohammed-Dabo
Keyword(s):  
Tannic Acid ◽  
Fungal Species ◽  
Soil Samples ◽  
Potato Dextrose Agar ◽  
Laccase Production ◽  
Curvularia Lunata ◽  
Main Campus ◽  
Fungal Isolates ◽  
Screening And Identification ◽  
Decaying Wood

Laccases are oxidases with broad substrate specificity and ability to oxidize various phenolic and non-phenolic compounds. This study was carried out to isolate and characterizes laccase producing fungi from environment samples. Soil and decaying wood samples were collected from different locations within Ahmadu Bello University, Zaria Main campus. Suspensions of the samples (1 g in 10 mL sterile distilled water) were serially diluted, inoculated onto Potato Dextrose Agar (PDA) containing 0.01% Chloramphenicol and incubated for 7 days at 30oC.The fungal isolates were characterized macroscopically and microscopically with the aid of an atlas. The identified fungal isolates were screened for laccase production by inoculating onto PDA containing 0.02% Guaiacol, 1mM ABTS (2 2’-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) and 0.5% Tannic acid as indicator compounds and incubated at 250C for 7 days. The laccase producing isolates were confirmed molecularly by ITS rDNA sequence analysis using the FASTA algorithm with the Fungus database from the European Bioinformatics Institute (EBI).A total of 25 fungal species (11 from soil and 14 from decaying wood samples) were isolated. Two isolates from the soil origin identified as Curvularia lunata SSI7 (Accession No. QIE06317.1) and Fusarium clade VII SSI3 (Accession No. GQ505677) were found to produce laccase where Curvularia lunata SSI7 was able to oxidize all the indicator compounds used for the screening. Fusarium clade VII SSI3 was able to oxidize only 0.5% Tannic acid. Laccase producing Curvularia lunata and Fusarium clade VII were isolated from soil samples collected from ABU Zaria Main Campus. Keywords: laccase, fungi, soil, decaying wood

scholarly journals On the fossil Remains of Panochthus Burmeister, 1866 (Xenarthra, Cingulata, Glyptodontidae) from the Pleistocene of southern Brazil

2015 ◽  
Vol 87 (1) ◽  
pp. 15-27 ◽  
Author(s):  
José D. Ferreira ◽  
Martín Zamorano ◽  
Ana Maria Ribeiro
Keyword(s):  
South America ◽  
Rio Grande ◽  
Species Level ◽  
External Morphology ◽  
Latitudinal Distribution ◽  
Southern Brazil ◽  
Rio Grande Do Sul ◽  
Diagnostic Features ◽  
New Material

The genus Panochthus represents the last lineage of "Panochthini" recorded in the Pleistocene. This genus has a wide latitudinal distribution in South America, and in Brazil it occurs in the southern and northeastern regions. In this paper we describe new material (isolated osteoderms and caudal tube fragments) assigned to Panochthus from the state of Rio Grande do Sul (southern Brazil) and discuss some taxonomic issues related to Panochthus tuberculatus and Panochthus greslebini based on this material . The occurrence of P. greslebini is the first for outside the Brazilian Intertropical Region. In addition, we describe new diagnostic features to differentiate the osteoderms of P. greslebini and P. tuberculatus. Unfortunately, it was not possible to identify some osteoderms at the species level. Interestingly, they showed four distinct morphotypes characterized by their external morphology, and thus were attributed to Panochthus sp. Lastly, we conclude that in addition to P.tuberculatus registered to southern Brazil, there is another species of the genus, assignable to P. cf. P. greslebini. Our analysis reinforce the reliability of caudal tube characters for the classification of species of Panochthus.

scholarly journals Bacteriophages LIMElight and LIMEzero of Pantoea agglomerans, Belonging to the “phiKMV-Like Viruses”

2011 ◽  
Vol 77 (10) ◽  
pp. 3443-3450 ◽  
Author(s):  
Evelien M. Adriaenssens ◽  
Pieter-Jan Ceyssens ◽  
Vincent Dunon ◽  
Hans-Wolfgang Ackermann ◽  
Johan Van Vaerenbergh ◽  
...  
Keyword(s):  
Soil Samples ◽  
Pantoea Agglomerans ◽  
Open Reading Frames ◽  
Human Pathogen ◽  
Content Type ◽  
Host Diversity ◽  
Double Stranded Dna ◽  
Opportunistic Human Pathogen ◽  
Reading Frames

ABSTRACTPantoea agglomeransis a common soil bacterium used in the biocontrol of fungi and bacteria but is also an opportunistic human pathogen. It has been described extensively in this context, but knowledge of bacteriophages infecting this species is limited. Bacteriophages LIMEzero and LIMElight ofP. agglomeransare lytic phages, isolated from soil samples, belonging to thePodoviridaeand are the firstPantoeaphages of this family to be described. The double-stranded DNA (dsDNA) genomes (43,032 bp and 44,546 bp, respectively) encode 57 and 55 open reading frames (ORFs). Based on the presence of an RNA polymerase in their genomes and their overall genome architecture, these phages should be classified in the subfamily of theAutographivirinae, within the genus of the “phiKMV-like viruses.” Phylogenetic analysis of all the sequenced members of theAutographivirinaesupports the classification of phages LIMElight and LIMEzero as members of the “phiKMV-like viruses” and corroborates the subdivision into the different genera. These data expand the knowledge ofPantoeaphages and illustrate the wide host diversity of phages within the “phiKMV-like viruses.”

Sign in / Sign up

Export Citation Format

Share Document