scholarly journals Macroscopic-microscopic characteristics and AFLP fingerprint for identification of Erythroxylum novogranatense, E. cambodianum and E. cuneatum endemic to Thailand

2020 ◽  
Vol 11 (4) ◽  
pp. 6144-6154
Author(s):  
Somdet Katib ◽  
Kanchana Rungsihirunrat
Keyword(s):  
Fragment Length Polymorphism ◽  
Morphological Characteristics ◽  
Gastrointestinal Diseases ◽  
Morphological Characters ◽  
Microscopic Investigation ◽  
Correct Identification ◽  
Phloem Tissue ◽  
Individual Values ◽  
Palisade Cell ◽  
Standard Guideline

Erythroxylum novogranatense (Morris) Hieron, E. cambodianum  Pierre and E. cuneatum (Miq.) Kurz  in family Erythroxylaceae was traditionally used as an antipyretic, general stimulant and gastrointestinal diseases. Due to their morphological similarity, the correct identification was necessary for the quality control in herbal medicine. E. novogranatense  (Morris) Hieron, E. cambodianum  Pierre  and E. cuneatum (Miq.) Macroscopic and microscopic characteristics evaluated Kurz endemic to Thailand according to WHO standard guideline and amplified fragment length polymorphism (AFLP) fingerprint. Morphological characters of E. novogranatense, E. cambodianum and E. cuneatum  were similar in their flower, fruit and seed but different in stem and leaf. Microscopic characteristics from these three species, including constant leaf numbers, showed individual values. The stomata were classified as paracytic type.  The midrib transverse section showed distinct characters of the epidermis, palisade cell, stomata, spongy cell, parenchyma, xylem vessel, phloem tissue and collenchyma. AFLP fingerprint showed highly polymorphisms 97.42% with the number of bands (349 bands) ranging between 50-750 bands. Primer E+ACG/M+CTT had the highest number of AFLP band (91 bands). The dendrogram generated from UPGMA could separate these three species. In summary, the combination of morphological characteristics, microscopic investigation and AFLP fingerprinting can be used to identify plant species and determine the genetic relationship among three Erythroxylum species.

Inheritance of Some Morphological Characteristics of Parental Lines in Mustard-Rape Hybrid

2020 ◽  
pp. 23-30
Keyword(s):  
First Generation ◽  
Agronomic Traits ◽  
Morphological Characteristics ◽  
Morphological Characters ◽  
Hybrid Plant ◽  
Distant Hybridization ◽  
Degree Of Dominance ◽  
Whole Plant ◽  
Row Width ◽  
The Difference

Distant hybridization is known to play an important role in expanding the gene pool of any crop. It is believed that the combination of different genomes in one nucleus, as a rule, is accompanied by the phenomenon of “genomic shock”, resulting in a variety of genetic and epigenetic changes. This provides a wealth of material for the selection of genotypes adapted to different environmental conditions. Interspecific hybrids in different combinations were obtained in the genus Brassica, however, until now, interest in distant hybridization in this genus has not died out, since such important crops as rapeseed and mustard demand an improvement of many important agronomic traits. The aim of this work was to study the degree of manifestation of morphological characters of a leaf, flower, and plant as a whole in the hybrid obtained by crossing of brown mustard of the variety Slavyanka and a collection specimen of spring rape. Seeds were sown in the spring of 2019 in a field with 30 cm row width. During the flowering period a number of morphological characters of a flower, leaf, and the whole plant were analyzed. Each parameter was evaluated with 10 plants. The degree of dominance in first-generation hybrid was calculated by the formula of Beil, Atkins (1965). The dominance coefficients were not determined in the case when the difference between the parental samples was insignificant. Differences between parental samples were determined by Student t-test. The level of heterosis was calculated according to the formula of Rasul et al (2002). In a mustard-rapeseed hybrid, the size of the leaves of the lower row was inherited by the type of rapeseed, which had larger leaves than mustard. The height of the hybrid plant was inherited by the type of mustard (hp = 1.32, Ht = 4.89%), and intermediate inheritance was observed for the length of the internodes (hp = -0.48). The size of the flower petals and sepals was inherited by the type of rapeseed, and significant heterosis was observed for the length of the pistil (Ht = 33.57%). The data obtained are of interest for understanding the interaction of genes of different genomes in the genus Brassica.

scholarly journals Morphometry and Phylogeny of the Different Populations of Selaginella tamariscina (P. Beauv.) Spring and S. pulvinata (Hook. & Grev.) Maxim. in Northern Thailand

2021 ◽  
Vol 20 (4) ◽  
Author(s):  
Udon Pongkawong ◽  
◽  
Jatupol Kampuansai ◽  
Rossarin Pollawatn ◽  
Arunothai Jampeetong ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Southern China ◽  
Phylogenetic Analyses ◽  
Dna Barcode ◽  
Morphological Characteristics ◽  
Taxonomic Status ◽  
Morphological Characters ◽  
The Philippines ◽  
Northern Thailand ◽  
Selaginella Tamariscina

Abstract “Dok Hin” is the Thai local name for Selaginella species that form rosettes. They commonly distributes in Siberia, Manchuria, southern China, Japan, the Philippines and Thailand. Morphology of Dok Hin is very resemble leading to misidentification. So, exactly number of species of Dok Hin in Thailand and their differences in morphological characteristics is not well understood. Thus, revision of morphological characters and phylogenetic confirmation of the taxonomic identification are needed. This study aims to examine morphological charateristics and phylogenetic patterns in eight populations of the Dok Hin in Northern Thailand. Morphology of Dok Hin from each populations was quantitatively examined using 15 vegetative and 6 reproductive characters meanwhile phylogenetic analyses was explored by DNA barcode ITS2. The results of the phylogenetic analysis revealed the existence of two species of Dok Hin, S. tamariscina and S. pulvinata. Selaginella tamariscina can be distinguished from S. pulvinata by its presence of a pseudotrunk above ground and ridges of dorsal leaves. On the other hand, the results of phylogenetic analysis indicated the differences among populations of S. pulvinata as well. Chiang Mai populations of S. pulvinata was characterized by peculiar set of characters long leaves and leaf apices look like caudate, while the rest of their populations have shorter leaves and leaf apices look like aristate. It indicates that S. pulvinata has genetic and phenotypic divergence among populations. However, additional studies of Dok Hin populations in other parts of Thailand and studies on different genetic markers are necessary to confirm the taxonomic status of S. pulvinata. Keywords: Dok Hin, Morphometric, Phylogeny, Pseudotrunk, Resurrection plant

scholarly journals Gübrelemenin Kayacık (Ostrya carpinifolia Scop.) Fidanlarının Morfolojik Gelişimine Etkisi

2016 ◽  
Vol 4 (10) ◽  
pp. 813 ◽  
Author(s):  
Şemsettin Kulaç ◽  
Özge Yıldız
Keyword(s):  
Morphological Characteristics ◽  
Vegetation Period ◽  
Morphological Characters ◽  
Morphological Development ◽  
Compound Fertilizer ◽  
Seedling Length ◽  
Collar Diameter ◽  
Root Collar ◽  
Ostrya Carpinifolia ◽  
Made In

In this study, in order to help the mass production of seedlings, the effect of fertilization on the morphological development of hornbeam leafy European hophornbeam (Ostry carpinifolia Scop) seedlings were investigated. For this, seedlings, which were obtained from the seeds coming from different European hophornbeam populations (Düzce-Yığılca, Antalya-Finike, Antalya-Akseki, Kastamonu-Şehdağ ve Adana-Saimbeyli) from various parts of Turkey, were used. European hophornbeam seedlings were treated with different fertilizers, including urea, ammonium sulphate, compound fertilizer 15-15-15 and 20-20-0, and 6-9 months Osmocote release fertilizer, and effects of these fertilizers on the morphological characters were investigated. Fertilization contained the same amount of nitrogen, and was made in three different ways; (1) mixing with habitat, (2) topical application and (3) liquid application. The development of germinated European hophornbeam seeds, which were spring-sowed in the same medium were monitored during the vegetation period. At the end of vegetation period, seedlings were removed from the soil and morphological characteristics of root (seedling length, root collar diameter, root length, fresh root and stem weight of the seedlings, dried root and stem weight of the seedlings and bud number) were measured. As a result, it was observed that fertilization positively affects the development of seedlings and depending on the fertilization type the seedlings of European hophornbeam populations were found to exhibit different improvements/growing. In addition, 6-9 months Osmocote release fertilizers were determined to be the best fertilizers affecting the morphological (diameter and height) development of European hophornbeam populations effectively, and among the populations, Düzce and Kastamonu populations showed the best improvement/growing.

scholarly journals First Report of Fusarium pernambucanum Causing Fruit Rot of Muskmelon in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xianping Zhang ◽  
Jiwen Xia ◽  
Jiakui Liu ◽  
Dan Zhao ◽  
Lingguang Kong ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Apical Cell ◽  
Morphological Characteristics ◽  
Fruit Rot ◽  
Likelihood Method ◽  
Correct Identification ◽  
Pathogenicity Test ◽  
First Report ◽  
The Core ◽  
Representative Isolate

Muskmelon (Cucumis melo L.) is one of the most widely cultivated and economically important fruit crops in the world. However, many pathogens can cause decay of muskmelons; among them, Fusarium spp. is the most important pathogen, affecting fruit yield and quality (Wang et al. 2011). In May 2017, fruit rot symptoms were observed on ripening muskmelons (cv. Jipin Zaoxue) in several fields in Liaocheng of Shandong Province, China. Symptoms appeared as brown, water-soaked lesions, irregularly circular in shape, with the lesion size ranging from a small spot (1 to 2 cm) to the decay of the entire fruit. The core and the surface of the infected fruit were covered with white to rose-reddish mycelium. Two infected muskmelons were collected from each of two fields, 10 km apart. Tissues from the inside of the infected fruit were surface disinfected with 75% ethanol for 30 s, and cultured on potato dextrose agar (PDA) at 25 °C in the dark for 5 days. Four purified cultures were obtained using the single spore method. On carnation leaf agar (CLA), macroconidia had a pronounced dorsiventral curvature, falcate, 3 to 5 septa, with tapered apical cell, and foot-shaped basal cell, measuring 19 to 36 × 4 to 6 μm. Chlamydospores were abundant, 5.5–7.5 μm wide, and 5.5–10.5 μm long, ellipsoidal or subglobose. No microconidia were observed. These morphological characteristics were consistent with the descriptions of F. pernambucanum (Santos et al. 2019). Because these isolates had similar morphology, one representative isolate was selected for multilocus phylogenetic analyses. DNA was extracted from the representative isolate using the CTAB method. The nucleotide sequences of the internal transcribed spacers (ITS) (White et al. 1990), translation elongation factor 1-α gene (TEF1), RNA polymerase II second largest subunit gene (RPB2), calmodulin (CAM) (Xia et al. 2019) were amplified using specific primers, sequenced, and deposited in GenBank (MN822926, MN856619, MN856620, and MN865126). Based on the combined dataset of ITS, TEF1, RPB2, CAM, alignments were made using MAFFT v. 7, and phylogenetic analyses were processed in MEGA v. 7.0 using the maximum likelihood method. The studied isolate (XP1) clustered together with F. pernambucanum reference strain URM 7559 (99% bootstrap). To perform pathogenicity test, 10 μl of spore suspensions (1 × 106 conidia/ml) were injected into each muskmelon fruit using a syringe, and the control fruit was inoculated with 10 μl of sterile distilled water. There were ten replicated fruits for each treatment. The test was repeated three times. After 7 days at 25 °C, the interior of the inoculated muskmelons begun to rot, and the rot lesion was expanded from the core towards the surface of the fruit, then white mycelium produced on the surface. The same fungus was re-isolated from the infected tissues and confirmed to fulfill the Koch’s postulates. No symptoms were observed on the control muskmelons. To our knowledge, this is the first report of F. pernambucanum causing of fruit rot of muskmelon in China. Considering the economic value of the muskmelon crop, correct identification can help farmers select appropriate field management measures for control of this disease.

scholarly journals Interactive key (Lucid) for identification of fungi in vegetable seeds

2020 ◽  
Vol 46 (1) ◽  
pp. 14-19
Author(s):  
Caroline Geraldi Pierozzi ◽  
Ricardo Toshio Fujihara ◽  
Efrain de Santana Souza ◽  
Marília Pizetta ◽  
Maria Márcia Pereira Sartori ◽  
...  
Keyword(s):  
High Resolution ◽  
Prior Knowledge ◽  
Undergraduate Students ◽  
Morphological Characters ◽  
Fungal Species ◽  
Ease Of Use ◽  
Identification Accuracy ◽  
Difficulty Level ◽  
Identification System ◽  
Correct Identification

ABSTRACT Interactive keys are tools that aid research and technical work since identification of organisms has become increasingly present in the scientific and academic context. An interactive key was developed with the software Lucid v. 3.3 for the identification of eleven fungal species associated with onion, carrot, pepper and tomato seeds. It was based on a matrix composed of six features: crop, conidium, conidiophore, color of long conidiophore, color of mycelium and presence of setae, besides 21 character states. In addition, descriptions, illustrations and high-resolution photographs of the morphological characters and states were made available to aid in the correct identification of fungal species. Validation of the interactive key was performed by distinct groups of volunteers: (i) graduate students with prior knowledge and using the interactive key; (ii) undergraduate students with little prior knowledge and using the interactive key, and (iii) undergraduate students with little prior knowledge and using the conventional identification system such as the printed manuals used in seed pathology laboratories. We analyzed the time spent by each volunteer to evaluate 25 seeds infected with the fungal species in the key, as well as the percentage of success and the difficulty level for each participant. The high percentage of correct answers with the use of the interactive key and the ease of use by the volunteers confirmed its efficiency because there was an increase in the identification accuracy when compared to the conventional system. Furthermore, the rate of success and the difficulty level presented low variability within groups (i) and (ii). These results are a consequence of the interaction of the user with characteristics of the developed tool, such as high-resolution photographs, which faithfully reproduce the fungal characteristics observed in the seeds under a stereomicroscope. Thus, the interactive key presented here can aid in teaching, institutional and commercial research, inspection and certification of seeds, making diagnosis safer and more accurate. The key is available for free at https://keys.lucidcentral.org/keys/v3/seed_fungi/.

scholarly journals Study morphology of loquat plants (Eriobotrya Japonica Lindl.) from Karo, Dairi, and Simalungun Districts, North Sumatra

2021 ◽  
Vol 912 (1) ◽  
pp. 012103
Author(s):  
Elimasni ◽  
R A Nasution
Keyword(s):  
Binary Data ◽  
Morphological Characteristics ◽  
Morphological Characters ◽  
Seed Morphology ◽  
Flowering Plant ◽  
Morphological Data ◽  
Eriobotrya Japonica ◽  
Morphological Observation ◽  
Limited Information ◽  
The Public

Abstract Abstrak. Loquat (Eriobotrya japonica Lindl.) is a flowering plant that belongs to the Rosacea family. The loquat has many health benefits. Cultivation and information about loquat plants in Indonesia are still limited, so they are rarely found and known by the public. Limited information and data regarding loquat plants is also an obstacle to the development of loquat plants. Research on loquat plants aims to analyze the morphological characters in three districts, namely, Karo, Dairi, and Simalungun districts. This research was conducted using a descriptive method. The analysis of the morphological characteristics of loquat plants using morphological data scoring into binary data. The similarity between individuals was analyzed using clusters with the NTSYS program version 2.0 with the UPGMA method of the SimQual function. Morphological Observation Results Loquat plants (Eriobotrya japonica Lindl.) in Karo, Dairi, and Simalungun Districts have uniform characters in the morphology of stems, leaves, and flowers. However, the observed fruit and seed morphology showed different characters. Different characters exist in the shape of the fruit and seeds. The morphological similarity level of loquat plants was grouped at a similarity coefficient value of 95%. Clusters I and II have the highest similarity with a coefficient value of 100%. Cluster III has the lowest similarity with a coefficient value of 97%.

scholarly journals Relationships among Morphological Characters, Isozymes Polymorphism and DNA Variability – the Impact on Lactuca Germplasm Taxonomy

2011 ◽  
Vol 39 (No. 2) ◽  
pp. 59-67 ◽  
Author(s):  
I. Doležalová ◽  
A. Lebeda ◽  
M. Dziechciarková ◽  
E. Křístková ◽  
D. Astley ◽  
...  
Keyword(s):  
Dna Content ◽  
Fragment Length Polymorphism ◽  
Morphological Variability ◽  
Morphological Characters ◽  
Aflp Analysis ◽  
Dapi Staining ◽  
Lactuca Species ◽  
Relative Dna Content ◽  
The Impact

Fifty one accessions of nineteen Lactuca species, the hybrid L. serriola × L. sativa and the related species Mycelis muralis were evaluated for morphological variability, esterase (EST) polymorphism, Amplified Fragment Length Polymorphism (AFLP) and relative DNA content. Sixteen Lactuca accessions were classified taxonomically on the basis of morphology, isozyme analysis and AFLP. Twenty-eight bands (isoforms) of EST were recorded allowing 82% of accessions to be distinguished. The relative DNA content, measured using flow-cytometry (DAPI staining), ranged from 2.02 pg in L. capensis to 17.96 pg in L. canadensis. The results from AFLP analysis and the relative DNA content measurement corresponded well with recent taxonomic classification of the genus Lactuca.  

Taxonomic Synopsis of Eriosema (Leguminosae: Papilionoideae, Phaseoleae) in Brazil

Phytotaxa ◽  
2019 ◽  
Vol 416 (2) ◽  
pp. 91-137 ◽  
Author(s):  
ELISA SILVA CÂNDIDO ◽  
WANDERLEIA DE VARGAS ◽  
LUÍSA MARIA DE PAULA ALVES BEZERRA ◽  
VIDAL DE FREITAS MANSANO ◽  
MOHAMMAD VATANPARAST ◽  
...  
Keyword(s):  
Field Work ◽  
Morphological Characters ◽  
Second Step ◽  
Correct Identification ◽  
Type Specimens ◽  
Distribution Maps ◽  
Savanna Vegetation ◽  
Tropical Environments ◽  
Species Complexes ◽  
Representative Species

Eriosema is a pantropical genus occurring mostly in savanna vegetation and grasslands of tropical environments, with approximately 150 species and two centers of diversity, one in Africa with about 110 species, and the other in the Neotropics with about 40 species. Considering the large number of Eriosema taxa in Brazil, including five recently described, and the lack of recent study that encompasses all species that occur in the country, a taxonomic synopsis of the Brazilian species of Eriosema was needed and is presented here. Herbaria collections, including type specimens, were consulted and field work was carried out in Brazil. Our study records 35 Eriosema species in Brazil, which concentrates most of the diversity of the genus in the Americas (85%; 35 out of 41 species). Most of this diversity occurs in the Central Brazilian savannas, particularly in the states of Goiás (29 taxa, eight endemic), and Minas Gerais (26 taxa, four endemic). Among all American species in the genus, Eriosema simplicifolium and E. crinitum have the broadest geographical distributions, and occur throughout Brazil and most part of the American continent. They form species complexes and future detailed studies will be necessary in order to understand taxon boundaries and delimitations. An identification key, taxon descriptions, information about type specimens as well as information on the habitat, phenological and geographical records, together with distribution maps, images of representative species in the field and the main morphological characters are provided to assist in the correct identification of this group of savanna plants. We also present 15 lectotypifications, out of which three are second-step.

scholarly journals Morphological variability of acorns and its taxonomic significance in Quercus. from Turkey

2015 ◽  
Vol 43 (3) ◽  
pp. 293-299 ◽  
Author(s):  
Y Bakis ◽  
MT Babaç
Keyword(s):  
Principal Component Analysis ◽  
Morphological Variability ◽  
Morphological Characteristics ◽  
Principal Component ◽  
Component Analysis ◽  
Morphological Characters ◽  
Taxonomic Significance ◽  
Morphological Variations ◽  
Quercus Species ◽  
Different Populations

Morphological variations of acorn among and within the groups of Quercus species were studied. A total of 617 acorns belonging to 14 species representing all 3 sections of Quercus L. (Fagaceae) in Turkey were examined in this study. Specimens were collected from 47 different populations over both Anatolian and Thrace part of Turkey. Principal component analysis was used to analyze the morphological characteristics of acorns. Results obtained from this study demonstrate the use of morphological characters in differentiating the taxa of Quercus and Cerris sections studied. Another important finding is the introgression among the acorns of species within Quercus section DOI: http://dx.doi.org/10.3329/bjb.v43i3.21601 Bangladesh J. Bot. 43(3): 293-299, 2014 (December)

scholarly journals First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 456-456 ◽  
Author(s):  
G. Mercado Cárdenas ◽  
M. Galván ◽  
V. Barrera ◽  
M. Carmona
Keyword(s):  
Rhizoctonia Solani ◽  
Morphological Characteristics ◽  
Its Region ◽  
Morphological Characters ◽  
Anastomosis Group ◽  
Staining Procedure ◽  
Nuclear Staining ◽  
Tobacco Plants ◽  
First Report ◽  
Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Sign in / Sign up

Export Citation Format

Share Document