scholarly journals Closing the Gaps to Understand the Tick Transmission of Anaplasma marginale among Giant Anteaters (Myrmecophaga tridactyla) in Argentina

Pathogens ◽  
2020 ◽  
Vol 9 (12) ◽  
pp. 1033
Author(s):  
Eliana Carolina Guillemi ◽  
Mélody Imbert ◽  
Sofia de la Fournière ◽  
María Marcela Orozco ◽  
Jorge Peña Martinez ◽  
...  
Keyword(s):  
Tandem Repeats ◽  
Dna Amplification ◽  
Anaplasma Marginale ◽  
Simultaneous Occurrence ◽  
Blood Samples ◽  
Transmission Cycle ◽  
Closing The Gaps ◽  
In The Wild ◽  
Tick Transmission ◽  
Species Specific

Anaplasma marginale, a well-known cattle pathogen of tropical and subtropical world regions, has been previously molecularly characterized in a giant anteater (Myrmecophaga tridactyla) from Corrientes, Argentina. Ticks or other hematophagous arthropod involved in the wild transmission cycle remained unknown. The aim of the present study was to analyze the simultaneous occurrence of A. marginale in blood samples and ticks from giant anteaters from Corrientes in order to investigate if ticks could be relevant in the transmission among these mammals. Blood samples from 50 giant anteaters collected in different years and 26 ticks Amblyomma dubitatum and A. sculptum were studied through the molecular amplification of two unequivocal species-specific genes from A. marginale: msp5 and msp1β. Twenty five giant anteaters and tick organs (salivary glands, gut and oviduct) from 11 ticks tested positive to the A. marginale DNA amplification. The further molecular characterization through MSP1a tandem repeats analysis revealed the presence of genotypes circulating among giant anteaters that had been previously identified in cattle blood samples from the same geographical region. These results confirm the presence of A. marginale in giant anteaters in Corrientes and suggests that A. dubitatum and A. sculptum ticks could be involved in the transmission among giant anteaters. Future studies will determine the role of these tick species in the wild transmission cycle in the study area and the eventual connection with the domestic cycle.

Self-amplification of satellite DNA in vitro

Genome ◽  
1998 ◽  
Vol 41 (3) ◽  
pp. 429-434 ◽  
Author(s):  
J B Buntjer ◽  
J A Lenstra
Keyword(s):  
Tandem Repeat ◽  
Satellite Dna ◽  
Genomic Dna ◽  
Tandem Repeats ◽  
Repeat Unit ◽  
Dna Amplification ◽  
Repeat Units ◽  
Rapid Amplification ◽  
Species Specific

We describe a PCR-like reaction in which genomic DNA acts as a template as well as a primer. Interaction between genomic tandem repeat units leads to self-amplification of satellite DNA. This genomic self-priming PCR (GSP-PCR) allowed the rapid amplification of species-specific tandem repeats of horse, cattle, dolphin, and chicken. A novel specific satellite of ostrich with a repeat unit of 60 bp was isolated using this method.Key words: satellite DNA, amplification, isolation, species-specific probes.

A species-specific satellite DNA from the entomopathogenic nematode Heterorhabditis indicus

Genome ◽  
1998 ◽  
Vol 41 (2) ◽  
pp. 148-153 ◽  
Author(s):  
Monique Abadon ◽  
Eric Grenier ◽  
Christian Laumond ◽  
Pierre Abad
Keyword(s):  
Dna Sequence ◽  
Satellite Dna ◽  
Tandem Repeats ◽  
Sequence Data ◽  
Entomopathogenic Nematode ◽  
Consensus Sequence ◽  
Repeated Sequence ◽  
Nucleotide Sequence Analysis ◽  
Specific Sequence ◽  
Species Specific

An AluI satellite DNA family has been cloned from the entomopathogenic nematode Heterorhabditis indicus. This repeated sequence appears to be an unusually abundant satellite DNA, since it constitutes about 45% of the H. indicus genome. The consensus sequence is 174 nucleotides long and has an A + T content of 56%, with the presence of direct and inverted repeat clusters. DNA sequence data reveal that monomers are quite homogeneous. Such homogeneity suggests that some mechanism is acting to maintain the homogeneity of this satellite DNA, despite its abundance, or that this repeated sequence could have appeared recently in the genome of H. indicus. Hybridization analysis of genomic DNAs from different Heterorhabditis species shows that this satellite DNA sequence is specific to the H. indicus genome. Considering the species specificity and the high copy number of this AluI satellite DNA sequence, it could provide a rapid and powerful tool for identifying H. indicus strains.Key words: AluI repeated DNA, tandem repeats, species-specific sequence, nucleotide sequence analysis.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals The Domestication of Evolution

1983 ◽  
Vol 10 (4) ◽  
pp. 283-292 ◽  
Author(s):  
Raymond P. Coppinger ◽  
Charles Kay Smith
Keyword(s):  
Life History ◽  
Sexual Maturity ◽  
Domestic Animals ◽  
Stable Environment ◽  
In The Wild ◽  
Species Specific

A coming ‘Age of Interdependent Forms’ seems destined to mark the success of what could be called ‘despecialized/interspecific fitness’ among neotenic strains (perpetuating juvenile traits) of species such as humans and domestic animals. Humans as well as the first domesticants underwent a neotenic evolution in the wild during the repeated interglacial periods which, acting on a number of mammalian forms, selected against adult species-specific ancestral adaptations to a stable environment. Neotenic species continue to look and behave more like ancestral youths than adults—even after sexual maturity and throughout their life-history. As they retain lifelong youthful dependency motivations, they can easily, under suitable conditions, become interdependent forms. By the time of melting of the last Pleistocene glacier, all the domestic partners had already become more dependency-prone than formerly, and were behaviourally despecialized enough to form the alliance that is now changing the order of Nature.

scholarly journals Transposable Elements in the Organization and Diversification of the Genome of Aegilops speltoides Tausch (Poaceae, Triticeae)

2018 ◽  
Vol 2018 ◽  
pp. 1-9 ◽  
Author(s):  
Olga Raskina
Keyword(s):  
Transposable Elements ◽  
Mobile Element ◽  
Plant Genome ◽  
Aegilops Speltoides ◽  
Genome Architecture ◽  
Different Types ◽  
In The Wild ◽  
Species Specific ◽  
Current Species

Repetitive DNA—specifically, transposable elements (TEs)—is a prevailing genomic fraction in cereals that underlies extensive genome reshuffling and intraspecific diversification in the wild. Although large amounts of data have been accumulated, the effect of TEs on the genome architecture and functioning is not fully understood. Here, plant genome organization was addressed by means of cloning and sequencing TE fragments of different types, which compose the largest portion of the Aegilops speltoides genome. Individual genotypes were analyzed cytogenetically using the cloned TE fragments as the DNA probes for fluorescence in situ hybridization (FISH). The obtained TE sequences of the Ty1-copia, Ty3-gypsy, LINE, and CACTA superfamilies showed the relatedness of the Ae. speltoides genome to the Triticeae tribe and similarities to evolutionarily distant species. A significant number of clones consisted of intercalated fragments of TEs of various types, in which Fatima (Ty3-gypsy) sequences predominated. At the chromosomal level, different TE clones demonstrated sequence-specific patterning, emphasizing the effect of the TE fraction on the Ae. speltoides genome architecture and intraspecific diversification. Altogether, the obtained data highlight the current species-specific organization and patterning of the mobile element fraction and point to ancient evolutionary events in the genome of Ae. speltoides.

scholarly journals Iterons Homologous to Helper Geminiviruses Are Essential for Efficient Replication of Betasatellites

2018 ◽  
Vol 93 (5) ◽  
Author(s):  
Xiongbiao Xu ◽  
Yajuan Qian ◽  
Yaqin Wang ◽  
Zhenghe Li ◽  
Xueping Zhou
Keyword(s):  
Tandem Repeats ◽  
Repeated Sequence ◽  
Iterative Sequence ◽  
Binding Motif ◽  
Sequence Motif ◽  
High Affinity ◽  
Efficient Replication ◽  
Tobacco Curly Shoot Virus ◽  
Species Specific ◽  
Origin Recognition

ABSTRACTBetasatellites associated with geminiviruses can be replicated promiscuously by distinct geminiviruses but exhibit a preference for cognate helper viruses. However, theciselements responsible for betasatellite origin recognition have not been characterized. In this study, we identified an iteron-like repeated sequence motif, 5′-GAGGACC-3′, in a tobacco curly shoot betasatellite (TbCSB) associated with tobacco curly shoot virus (TbCSV). Competitive DNA binding assays revealed that two core repeats (5′-GGACC-3′) are required for specific binding to TbCSV Rep; TbCSB iteron mutants accumulated to greatly reduced levels and lost the cognate helper-mediated replication preference. Interestingly, TbCSV also contains identical repeated sequences that are essential for specific Rep binding andin vivoreplication. In order to gain insight into the mechanism by which TbCSB has acquired the cognate iterons, we performed a SELEX (systematic evolution of ligands by exponential enrichment) assay to identify the high-affinity Rep binding ligands from a large pool of randomized sequences. Analysis of SELEX winners showed that all of the sequences contained at least one core iteron-like motif, suggesting that TbCSB has evolved to contain cognate iterons for high-affinity Rep binding. Further analyses of various betasatellite sequences revealed a region upstream of the satellite conserved region replete with iterative sequence motifs, including species-specific repeats and a general repeat (5′-GGTAAAT-3′). Remarkably, the species-specific repeats in many betasatellites are homologous to those in their respective cognate helper begomoviruses, whereas the general repeat is widespread in most of the betasatellite molecules analyzed. These data, taken together, suggest that many betasatellites have evolved to acquire homologous iteron-like sequences for efficient replication mediated by cognate helper viruses.IMPORTANCEThe geminivirus-encoded replication initiator protein (Rep) binds to repeated sequence elements (also known as iterons) in the origin of replication that serve as essentialciselements for specific viral replication. Betasatellites associated with begomoviruses can be replicated by cognate or noncognate helper viruses, but theciselements responsible for betasatellite origin recognition have not been characterized. Using a betasatellite (TbCSB) associated with tobacco curly shoot virus (TbCSV) as a model, we identify two tandem repeats (iterons) in the Rep-binding motif (RBM) that are required for specific Rep binding and efficient replication, and we show that identical iteron sequences present in TbCSV are also necessary for Rep binding and the replication of helper viruses. Extensive analysis of begomovirus/betasatellite sequences shows that many betasatellites contain iteron-like elements homologous to those of their respective cognate helper begomoviruses. Our data suggest that many betasatellites have evolved to acquire homologous iteron-like sequences for efficient replication mediated by cognate helper viruses.

scholarly journals Assessing the Psychological Priorities for Optimising Captive Asian Elephant (Elephas maximus) Welfare

Animals ◽  
2019 ◽  
Vol 10 (1) ◽  
pp. 39 ◽  
Author(s):  
Jake Stuart Veasey
Keyword(s):  
Cognitive Processes ◽  
Management Strategies ◽  
Asian Elephant ◽  
Evolutionary Significance ◽  
Identification System ◽  
Asian Elephants ◽  
In Captivity ◽  
In The Wild ◽  
Human Care ◽  
Species Specific

The welfare status of elephants under human care has been a contentious issue for two decades or more in numerous western countries. Much effort has gone into assessing the welfare of captive elephants at individual and population levels with little consensus having been achieved in relation to both the welfare requirements of captive elephants, or their absolute welfare status. A methodology capable of identifying the psychological priorities of elephants would greatly assist in both managing and assessing captive elephant welfare. Here, a Delphi-based Animal Welfare Priority Identification System© (APWIS©) is trialled to evaluate the reliability of the methodology and to determine the welfare significance of individual behaviours and cognitive processes for Asian elephants (Elaphus maximus). APWIS© examines the motivational characteristics, evolutionary significance and established welfare impacts of individual behaviours and cognitive processes of each species being assessed. The assessment carried out here indicates appetitive behaviours essential for survival in the wild, together species-specific social and cognitive opportunities are likely to be important to the welfare of Asian elephant in captivity. The output of this assessment, for the first time, provides comprehensive species-specific psychological/welfare priorities for Asian elephants that should be used to inform husbandry guidelines, habitat design and management strategies and can also provide a valuable reference tool for Asian elephant welfare assessment. The effective application of these insights could lead to substantive improvements in captive Asian elephant welfare.

scholarly journals Infection of Tick Cells and Bovine Erythrocytes with One Genotype of the Intracellular Ehrlichia Anaplasma marginale Excludes Infection with Other Genotypes

2002 ◽  
Vol 9 (3) ◽  
pp. 658-668 ◽  
Author(s):  
José de la Fuente ◽  
Jose C. Garcia-Garcia ◽  
Edmour F. Blouin ◽  
Jeremiah T. Saliki ◽  
Katherine M. Kocan
Keyword(s):  
United States ◽  
Tandem Repeats ◽  
Surface Protein ◽  
Anaplasma Marginale ◽  
The United States ◽  
The Other ◽  
Tick Cell ◽  
Anaplasma Ovis ◽  
Major Surface ◽  
Bovine Erythrocytes

ABSTRACT Anaplasma marginale, a tick-borne rickettsial pathogen of cattle, is endemic in several areas of the United States. Many geographic isolates of A. marginale that occur in the United States are characterized by the major surface protein 1a, which varies in sequence and molecular weight due to different numbers of tandem repeats of 28 or 29 amino acids. Recent studies (G. H. Palmer, F. R. Rurangirwa, and T. F. McElwain, J. Clin. Microbiol. 39:631-635, 2001) of an A. marginale-infected herd of cattle in an area of endemicity demonstrated that multiple msp1α genotypes were present but that only one genotype was found per individual bovine. These findings suggested that infection of cattle with other genotypes was excluded. The present study was undertaken to confirm the phenomenon of infection exclusion of A. marginale genotypes in infected bovine erythrocytes and cultured tick cells. Two tick-transmissible isolates of A. marginale, one from Virginia and one from Oklahoma, were used for these studies. In two separate trials, cattle inoculated with equal doses of the two isolates developed infection with only one genotype. Tick cell cultures inoculated with equal doses of the two isolates became infected with only the Virginia isolate of A. marginale. When cultures were inoculated with different ratios of the Oklahoma and Virginia isolates of A. marginale, the isolate inoculated in the higher ratio became established and excluded infection with the other. When cultures with established infections of one isolate were subsequently infected with the other, only the established isolate was detected. We documented infection exclusion during initial infection in cell culture by labeling each isolate with a different fluorescent dye. After 2 days in culture, only a single isolate was detected per cell by fluorescence microscopy. Finally, when Anaplasma ovis infections were established in cultures that were subsequently inoculated with the Virginia or Oklahoma isolate of A. marginale, A. marginale infection was excluded. These studies confirm that infection exclusion occurs with A. marginale in bovine erythrocytes and tick cells, resulting in the establishment of only one genotype, and appears to be the first report of infection exclusion for Anaplasma and Ehrlichia species.

Development of a diagnostic molecular marker for Philonema spp. (Nematoda; Dracunculoidea) infecting salmonids in British Columbia

1995 ◽  
Vol 52 (S1) ◽  
pp. 129-133 ◽  
Author(s):  
L. Després ◽  
M.L. Adamson ◽  
T.E. McDonald
Keyword(s):  
British Columbia ◽  
Sockeye Salmon ◽  
Pcr Amplification ◽  
Base Substitution ◽  
Rainbow Trout Oncorhynchus Mykiss ◽  
Nematode Parasites ◽  
Rdna Sequences ◽  
Morphological Criteria ◽  
In The Wild ◽  
Species Specific

We developed a species specific DNA probe based on differential PCR amplification that distinguishes two congeneric nematode parasites of salmonids in British Columbia: Philonema agubernaculum Simon and Simon, 1936, usually parasitic in lake resident rainbow trout, Oncorhynchus mykiss; and P. oncorhynchi Kuitunen-Ekbaum, 1933, parasitic in anadromous sockeye salmon, O. nerka. The region differentially amplified was the D3 expansion domain of the 28S rDNA. Sequences of the two species differ in two parts of the domain, one a single base substitution and the other a three base duplication in P. oncorhynchi. A primer specific to P. oncorhynchi (amplifying P. oncorhynchi, not P. agubernaculum) was defined in the duplication region. Using differential amplification, we showed that sockeye smolts are infected with P. agubernaculum, although returning adults harbour only P. oncorhynchi. This technique could conceivably be used to quantify the frequency of heterologous infections in the wild, before infecting worms are identifiable at the species level based on morphological criteria.

Sign in / Sign up

Export Citation Format

Share Document