scholarly journals The H+-pyrophosphatase IbVP1 regulates carbon flux to influence the starch metabolism and yield of sweet potato

2021 ◽  
Vol 8 (1) ◽  
Author(s):  
Weijuan Fan ◽  
Yandi Zhang ◽  
Yinliang Wu ◽  
Wenzhi Zhou ◽  
Jun Yang ◽  
...  
Keyword(s):  
Sweet Potato ◽  
Starch Content ◽  
Total Yield ◽  
Phloem Loading ◽  
Vital Role ◽  
Starch Metabolism ◽  
Fibrous Root ◽  
Storage Roots ◽  
Long Distance ◽  
Starch Production

AbstractStorage roots of sweet potato are important sink organs for photoassimilates and energy, and carbohydrate metabolism in storage roots affects yield and starch production. Our previous study showed that sweet potato H+-pyrophosphatase (IbVP1) plays a vital role in mitigating iron deficiency and positively controls fibrous root growth. However, its roles in regulating starch production in storage roots have not been investigated. In this study, we found that IbVP1 overexpression in sweet potato improved the photosynthesis ability of and sucrose content in source leaves and increased both the starch content in and total yield of sink tissues. Using 13C-labeled sucrose feeding, we determined that IbVP1 overexpression promotes phloem loading and sucrose long-distance transport and enhances Pi-use efficiency. In sweet potato plants overexpressing IbVP1, the expression levels of starch biosynthesis pathway genes, especially AGPase and GBSSI, were upregulated, leading to changes in the structure, composition, and physicochemical properties of stored starch. Our study shows that the IbVP1 gene plays an important role in regulating starch metabolism in sweet potato. Application of the VP1 gene in genetic engineering of sweet potato cultivars may allow the improvement of starch production and yield under stress or nutrient-limited conditions.

Enhanced Carbohydrate Metabolism and Salinity Tolerance of Tobacco Plants Overexpressing a Vacuolar H+-ATPase Subunit B2 (DoVHAb2) Gene from Yam (Dioscorea opposita Thunb.)

2021 ◽  
Vol 15 (4) ◽  
pp. 504-513
Author(s):  
Ying Shao ◽  
Yanfang Zhang ◽  
Shuchun Guo ◽  
Lingmin Zhao ◽  
Xiaohua Sun ◽  
...  
Keyword(s):  
Salinity Tolerance ◽  
Starch Content ◽  
Nacl Stress ◽  
Vital Role ◽  
Full Length ◽  
Starch Metabolism ◽  
Wild Type ◽  
Tobacco Plants ◽  
Atpase Subunit ◽  
Functional Studies

ATP synthase plays a vital role in plant growth and stress tolerance, functional studies of DoVHAb2 in yam tuber starch metabolism and salinity tolerance have so far not been reported. Full-length cloning and analysis of DoVHAb2 were conducted to ascertain its function. The gDNAs were cloned and analyzed. Quantitative real-time polymerase chain reaction (qRT-PCR) was probed in yam tuber developmental stage and different organs of DoVHAb2. Transient expression vector was constructed and injected into tobacco leaves to observe the subcellular localization of genes. Overexpressed fusion vector of gene was constructed and transformed into tobacco by Agrobacterium-mediated method to identify the function of DoVHAb2 gene. In the results, the full-length of DoVHAb2 was 1926 bp, encoding 488 amino acids, and it was divided into 14 exons and 15 introns, its highest expression was found in tubers than in stems and leaves in yam, the yam DoVHAb2 protein was localized to cytoplasm. The starch content, ADP glucose pyrophosphorylase, starch synthase and ATPase activity were significantly higher in transgenic tobacco plants than in the wild-type. The transgenic plants also had higher leaf differentiation rate, soluble protein content, superoxide dismutase and peroxidase activities, and lower malondialdehyde content than the wild type under NaCl stress. In conclusion, the results indicated that overexpression of DoVHAb2 enhanced starch metabolism and conferred salinity tolerance.

scholarly journals SWEET POTATO GROWTH AND ROOT DEVELOPMENT IN FRITTED CLAY MEDIA

HortScience ◽  
1990 ◽  
Vol 25 (8) ◽  
pp. 855F-855
Author(s):  
P. J. Ndolo ◽  
E. G. Rhoden
Keyword(s):  
Sweet Potato ◽  
Root Length ◽  
Dry Weight ◽  
The Other ◽  
Root Weight ◽  
Storage Root ◽  
Fibrous Root ◽  
Storage Roots ◽  
Potato Growth ◽  
Fibrous Roots

Root growth of sweet potato [Ipomoea batatas (L) Lam.] cvs `TI-82-155', `Centennial' and `Rojo Blanco' in coarse fritted clay soil, was investigated under greenhouse conditions. The sweet potato cultivars were harvested at 41 and 82 days after planting. Dry weight of fibrous roots of all cultivars were similar at day 41. Fibrous root weight of `Rojo Blanco' increased by 5% while those of the other cultivars increased by 168%. Mean fibrous root length per centimeter depth was not significantly different among cultivars. Although fresh weight of storage roots of `Rojo Blanco' was significantly lower than those of the other cultivars, their dry weights were similar. `TI-82-155' and `Rojo Blanco' had fewer storage roots compared to the other cultivars, however, storage root length of `TI-82-155' or `Rojo Blanco' was greater than that of `Georgia Jet' or `Centennial'. Length to diameter ratio of the storage root of `Rojo Blanco' was significantly greater than that of `TI-82-155' and `Georgia Jet'.

scholarly journals SWEET POTATO GROWTH AND ROOT DEVELOPMENT IN FRITTED CLAY MEDIA

HortScience ◽  
1990 ◽  
Vol 25 (8) ◽  
pp. 855f-855
Author(s):  
P. J. Ndolo ◽  
E. G. Rhoden
Keyword(s):  
Sweet Potato ◽  
Root Length ◽  
Dry Weight ◽  
The Other ◽  
Root Weight ◽  
Storage Root ◽  
Fibrous Root ◽  
Storage Roots ◽  
Potato Growth ◽  
Fibrous Roots

Root growth of sweet potato [Ipomoea batatas (L) Lam.] cvs `TI-82-155', `Centennial' and `Rojo Blanco' in coarse fritted clay soil, was investigated under greenhouse conditions. The sweet potato cultivars were harvested at 41 and 82 days after planting. Dry weight of fibrous roots of all cultivars were similar at day 41. Fibrous root weight of `Rojo Blanco' increased by 5% while those of the other cultivars increased by 168%. Mean fibrous root length per centimeter depth was not significantly different among cultivars. Although fresh weight of storage roots of `Rojo Blanco' was significantly lower than those of the other cultivars, their dry weights were similar. `TI-82-155' and `Rojo Blanco' had fewer storage roots compared to the other cultivars, however, storage root length of `TI-82-155' or `Rojo Blanco' was greater than that of `Georgia Jet' or `Centennial'. Length to diameter ratio of the storage root of `Rojo Blanco' was significantly greater than that of `TI-82-155' and `Georgia Jet'.

scholarly journals Starch Production in Chlamydomonas reinhardtii through Supraoptimal Temperature in a Pilot-Scale Photobioreactor

Cells ◽  
2021 ◽  
Vol 10 (5) ◽  
pp. 1084
Author(s):  
Ivan N. Ivanov ◽  
Vilém Zachleder ◽  
Milada Vítová ◽  
Maria J. Barbosa ◽  
Kateřina Bišová
Keyword(s):  
Chlamydomonas Reinhardtii ◽  
Starch Content ◽  
Light Availability ◽  
Fold Increase ◽  
Pilot Scale ◽  
Temperature Treatment ◽  
Control Culture ◽  
Starch Accumulation ◽  
Cellular Division ◽  
Starch Production

An increase in temperature can have a profound effect on the cell cycle and cell division in green algae, whereas growth and the synthesis of energy storage compounds are less influenced. In Chlamydomonas reinhardtii, laboratory experiments have shown that exposure to a supraoptimal temperature (39 °C) causes a complete block of nuclear and cellular division accompanied by an increased accumulation of starch. In this work we explore the potential of supraoptimal temperature as a method to promote starch production in C. reinhardtii in a pilot-scale photobioreactor. The method was successfully applied and resulted in an almost 3-fold increase in the starch content of C. reinhardtii dry matter. Moreover, a maximum starch content at the supraoptimal temperature was reached within 1–2 days, compared with 5 days for the control culture at the optimal temperature (30 °C). Therefore, supraoptimal temperature treatment promotes rapid starch accumulation and suggests a viable alternative to other starch-inducing methods, such as nutrient depletion. Nevertheless, technical challenges, such as bioreactor design and light availability within the culture, still need to be dealt with.

scholarly journals Molecular mechanism underlying the effect of maleic hydrazide treatment on starch accumulation in S. polyrrhiza 7498 fronds

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
Yerong Zhu ◽  
Xiaoxue Li ◽  
Xuan Gao ◽  
Jiqi Sun ◽  
Xiaoyuan Ji ◽  
...  
Keyword(s):  
Plant Growth ◽  
Carbon Fixation ◽  
Maleic Hydrazide ◽  
Starch Content ◽  
Vegetative Reproduction ◽  
Photosynthetic Pigment ◽  
Starch Accumulation ◽  
Chlorophyll Fluorescence Parameters ◽  
Significant Difference ◽  
Starch Production

Abstract Background Duckweed is considered a promising feedstock for bioethanol production due to its high biomass and starch production. The starch content can be promoted by plant growth regulators after the vegetative reproduction being inhibited. Maleic hydrazide (MH) has been reported to inhibit plant growth, meantime to increase biomass and starch content in some plants. However, the molecular explanation on the mechanism of MH action is still unclear. Results To know the effect and action mode of MH on the growth and starch accumulation in Spirodela polyrrhiza 7498, the plants were treated with different concentrations of MH. Our results showed a substantial inhibition of the growth in both fronds and roots, and increase in starch contents of plants after MH treatment. And with 75 µg/mL MH treatment and on the 8th day of the experiment, starch content was the highest, about 40 mg/g fresh weight, which is about 20-fold higher than the control. The I2-KI staining and TEM results confirmed that 75 µg/mL MH-treated fronds possessed more starch and big starch granules than that of the control. No significant difference for both in the photosynthetic pigment content and the chlorophyll fluorescence parameters of PII was found. Differentially expressed transcripts were analyzed in S. polyrrhiza 7498 after 75 µg/mL MH treatment. The results showed that the expression of some genes related to auxin response reaction was down-regulated; while, expression of some genes involved in carbon fixation, C4 pathway of photosynthesis, starch biosynthesis and ABA signal transduction pathway was up-regulated. Conclusion The results provide novel insights into the underlying mechanisms of growth inhibition and starch accumulation by MH treatment, and provide a selective way for the improvement of starch production in duckweed.

scholarly journals Quality Attributes of Malaysia Purple-Fleshed Sweet Potato at Different Peel Condition

Agronomy ◽  
2021 ◽  
Vol 11 (5) ◽  
pp. 872
Author(s):  
Nurfarhana Shaari ◽  
Rosnah Shamsudin ◽  
Mohd Zuhair Mohd Nor ◽  
Norhashila Hashim
Keyword(s):  
Vitamin C ◽  
Sweet Potato ◽  
Dry Matter ◽  
Nutritional Value ◽  
Amylose Content ◽  
Starch Content ◽  
Chemical Properties ◽  
Physical And Chemical Properties ◽  
Physical And Chemical ◽  
And Chemical Properties

In this study, physical and chemical properties (dry matter, ash, moisture, protein, fat, fiber, carbohydrate, starch, amylose, and vitamin C) of sweet potato tuber and flour of Anggun 1 cultivar were evaluated at different conditions. During peeling, the tuber and flour were processed subjected to three different conditions, which were unpeeled tubers (C1), peeled tubers (C2), and skin of tuber only (C3). From the results, the highest (p < 0.05) dry matter was observed in C1 while higher contents of ash, moisture, and protein were found in C3. Regarding the fat and vitamin C content, no significant differences (p > 0.05) were found between each condition. The highest fiber, carbohydrate, and amylose content (p < 0.05) were found in C1. The C1 and C2 reflected significantly higher (p < 0.05) starch content. Overall, these results provide important information about the peeling effect on the physical and chemical properties of Anggun 1. The information could be used as adding value to healthy food in the Malaysian diet due to the nutritional value of sweet potato.

Isolation and characterisation of invertase inhibitor from sweet potato storage roots

2008 ◽  
Vol 88 (15) ◽  
pp. 2615-2621 ◽  
Author(s):  
Guan-Jhong Huang ◽  
Ming-Jyh Sheu ◽  
Yuan-Shiun Chang ◽  
Te-Ling Lu ◽  
Heng-Yuan Chang ◽  
...  
Keyword(s):  
Sweet Potato ◽  
Potato Storage ◽  
Storage Roots ◽  
Invertase Inhibitor

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
B. Gao ◽  
R. Y. Wang ◽  
S. L. Chen ◽  
X. H. Li ◽  
J. Ma
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Storage Roots ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals POTENCIAL DE CLONES EXPERIMENTAIS DE BATATA-DOCE PARA PRODUÇÃO DE ETANOL

Nativa ◽  
2018 ◽  
Vol 6 (4) ◽  
pp. 352
Author(s):  
Adriano Mendes Lourenço ◽  
Aline Torquato Tavares ◽  
Tiago Alves Ferreira ◽  
Danilo Alves da Silva Porto Lopes ◽  
João Victor Gonçalves Carline ◽  
...  
Keyword(s):  
Ethanol Production ◽  
Sweet Potato ◽  
Ipomoea Batatas ◽  
Ethanol Yield ◽  
Starch Content ◽  
Great Ability ◽  
Ethanol Yields ◽  
Root Starch ◽  
Breeding Selection ◽  
Starch Yield

A batata-doce (Ipomoea batatas (L.) Lam.) tem sido reportada como uma das espécies de planta com grande capacidade de converter biomassa em matéria prima para produção de etanol. O objetivo do trabalho foi avaliar o potencial de clones de batata-doce para produção de etanol. Foram avaliados 60 clones de batata-doce para produtividade de raízes, teor de amido nas raízes, produtividade de amido, coloração da casca e da polpa e o rendimento de etanol. O clone BDTO#122,32 e as cultivares Ana Clara e Carolina Vitória com média de 46,77; 42,75 e 41,25 t ha-¹, respectivamente, foram os que mais conseguiram acumular biomassa na forma de raiz. Os clones que apresentam as maiores médias de produtividade de amido por hectare foram BDTO#144.22 e BDTO#100.23, com valores de 15,46 e 14,16% t ha-1, com rendimentos de etanol de 8,33 e 7,63 m³ ha-¹. Os clones BDTO#144.22 e BDTO#100.23 apresentaram as maiores médias de produtividade de amido por hectare e rendimento de etanol, sendo, portanto, os mais promissores para a produção de etanol.Palavras-chave: Ipomoea batatas (L.) Lam, melhoramento genético, seleção, biocombustível. POTENTIAL OF EXPERIMENTAL CLONES OF SWEET POTATO FOR ETHANOL PRODUCTION ABSTRACT:Sweet potato (Ipomoea batatas (L.) Lam.) Has been reported as one of the plant species with great ability to convert biomass into feedstock for ethanol production. The objective of this work was to evaluate the potential of sweet potato clones for ethanol production. Twenty-six sweet potato clones were evaluated for root productivity, root starch content, starch yield, bark and pulp color, and ethanol yield. Clone BDTO # 122.32 and cultivars Ana Clara and Carolina Vitória averaging 46.77; 42.75 and 41.25 t ha-1, respectively, were the ones that were able to accumulate biomass in the root form. The clones presenting the highest starch productivity per hectare were BDTO # 144.22 and BDTO # 100.23, with values of 15.46 and 14.16% t ha-1, with ethanol yields of 8.33 and 7.63 m³ ha-¹. The clones BDTO # 144.22 and BDTO # 100.23 showed the highest averages of starch productivity per hectare and yield of ethanol, thus being the most promising for the production of ethanol.Keywords: Ipomoea potatoes (L.) Lam, breeding, selection, biofuel.

Sign in / Sign up

Export Citation Format

Share Document