Two LysR family transcriptional regulators, McbH and McbN, activate the operons responsible for the midstream and downstream pathways of carbaryl degradation in Pseudomonas sp. strain XWY-1, respectively

Previously, a LysR family transcriptional regulator McbG that activates the mcbBCDEF gene cluster involved in the upstream pathway (from carbaryl to salicylate) of carbaryl degradation in Pseudomonas sp. strain XWY-1 has been identified by us ( Appl. Environ. Microbiol. 2021, 87(9): e02970-20.). In this study, we identified McbH and McbN, which activate mcbIJKLM cluster (responsible for the midstream pathway, from salicylate to gentisate) and mcbOPQ cluster (responsible for the downstream pathway, from gentisate to pyruvate and fumarate), respectively. They both belong to the LysR family of transcriptional regulators. Gene disruption and complementation study reveal that McbH is essential for transcription of the mcbIJKLM cluster in response to salicylate and McbN is indispensable for the transcription of the mcbOPQ cluster in response to gentisate. The results of electrophoretic mobility shift assay (EMSA) and DNase I footprinting showed that McbH binds to the 52-bp motif in the mcbIJKLM promoter area and McbN binds to the 58-bp motif in the mcbOPQ promoter area. The key sequence of McbH binding to mcbIJKLM promoter is a 13-bp motif that conforms to the typical characteristics of LysR family. However, the 12-bp motif that is different from the typical characteristics of the LysR family regulator binding site sequence is identified as the key sequence for McbN to bind to the mcbOPQ promoter. This study reveals the regulatory mechanism for the midstream and downstream pathway of carbaryl degradation in strain XWY-1 and further enriches the members of the LysR transcription regulator family. IMPORTANCE: The enzyme-encoding genes involved in the complete degradation pathway of carbaryl in Pseudomonas sp. strain XWY-1 include mcbABCDEF , mcbIJKLM and mcbOPQ . Previous studies demonstrated that the mcbA gene responsible for hydrolysis of carbaryl to 1-naphthol is constitutively expressed and the transcription of mcbBCDEF was regulated by McbG. However, the transcription regulation mechanisms of mcbIJKLM and mcbOPQ have not been investigated yet. In this study, we identified two LysR-type transcriptional regulators, McbH and McbN, which activate the mcbIJKLM cluster responsible for the degradation of salicylate to gentisate and mcbOPQ cluster responsible for the degradation of gentisate to pyruvate and fumarate, respectively. The 13-bp motif is critical for McbH to bind to the promoter of mcbIJKLM , and 12-bp motif different from the typical characteristics of the LTTR binding sequence affects the binding of McbN to promoter. These findings help to expand the understanding of the regulatory mechanism of microbial degradation of carbaryl.

Download Full-text

PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

Applied and Environmental Microbiology ◽

10.1128/aem.02122-15 ◽

2015 ◽

Vol 81 (23) ◽

pp. 8084-8092 ◽

Cited By ~ 5

Author(s):

Minggen Cheng ◽

Kai Chen ◽

Suhui Guo ◽

Xing Huang ◽

Jian He ◽

...

Keyword(s):

Binding Site ◽

Gene Cluster ◽

Transcriptional Start Site ◽

Transcriptional Activator ◽

Transcriptional Regulators ◽

Mobility Shift ◽

Content Type ◽

Dnase I Footprinting ◽

Dioxygenase Gene ◽

Mobility Shift Assay

ABSTRACTThe 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2Bcluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed inSphingobium wenxiniaestrain JZ-1Tby its substrate 3-PBA. In this study, we identified a transcriptional activator of thepbaA1A2Bcluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonassp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2Bcluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component genepbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in thepbaA1A2Bpromoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Download Full-text

McbG, a LysR Family Transcriptional Regulator, Activates the mcbBCDEF Gene Cluster Involved in the Upstream Pathway of Carbaryl Degradation in Pseudomonas sp. Strain XWY-1

Applied and Environmental Microbiology ◽

10.1128/aem.02970-20 ◽

2021 ◽

Vol 87 (9) ◽

Author(s):

Zhijian Ke ◽

Yidong Zhou ◽

Wankui Jiang ◽

Mingliang Zhang ◽

Hui Wang ◽

...

Keyword(s):

Binding Site ◽

Gene Cluster ◽

Transcriptional Activation ◽

Regulatory Mechanism ◽

Hydrolysis Product ◽

Transcriptional Regulator ◽

Transcriptional Regulators ◽

Palindromic Sequence ◽

Mobility Shift ◽

Lysr Family

ABSTRACT Although enzyme-encoding genes involved in the degradation of carbaryl have been reported in Pseudomonas sp. strain XWY-1, no regulator has been identified yet. In the mcbABCDEF cluster responsible for the upstream pathway of carbaryl degradation (from carbaryl to salicylate), the mcbA gene is constitutively expressed, while mcbBCDEF is induced by 1-naphthol, the hydrolysis product of carbaryl by McbA. In this study, we identified McbG, a transcriptional activator of the mcbBCDEF cluster. McbG is a 315-amino-acid protein with a molecular mass of 35.7 kDa. It belongs to the LysR family of transcriptional regulators and shows 28.48% identity to the pentachlorophenol (PCP) degradation transcriptional activation protein PcpR from Sphingobium chlorophenolicum ATCC 39723. Gene disruption and complementation studies reveal that mcbG is essential for transcription of the mcbBCDEF cluster in response to 1-naphthol in strain XWY-1. The results of the electrophoretic mobility shift assay (EMSA) and DNase I footprinting show that McbG binds to the 25-bp motif in the mcbBCDEF promoter area. The palindromic sequence TATCGATA within the motif is essential for McbG binding. The binding site is located between the –10 box and the transcription start site. In addition, McbG can repress its own transcription. The EMSA results show that a 25-bp motif in the mcbG promoter area plays an important role in McbG binding to the promoter of mcbG. This study reveals the regulatory mechanism for the upstream pathway of carbaryl degradation in strain XWY-1. The identification of McbG increases the variety of regulatory models within the LysR family of transcriptional regulators. IMPORTANCE Pseudomonas sp. strain XWY-1 is a carbaryl-degrading strain that utilizes carbaryl as the sole carbon and energy source for growth. The functional genes involved in the degradation of carbaryl have already been reported. However, the regulatory mechanism has not been investigated yet. Previous studies demonstrated that the mcbA gene, responsible for hydrolysis of carbaryl to 1-naphthol, is constitutively expressed in strain XWY-1. In this study, we identified a LysR-type transcriptional regulator, McbG, which activates the mcbBCDEF gene cluster responsible for the degradation of 1-naphthol to salicylate and represses its own transcription. The DNA binding site of McbG in the mcbBCDEF promoter area contains a palindromic sequence, which affects the binding of McbG to DNA. These findings enhance our understanding of the mechanism of microbial degradation of carbaryl.

Download Full-text

A Sequence of the CIS Gene Promoter Interacts Preferentially with Two Associated STAT5A Dimers: a Distinct Biochemical Difference between STAT5A and STAT5B

Molecular and Cellular Biology ◽

10.1128/mcb.18.10.5852 ◽

1998 ◽

Vol 18 (10) ◽

pp. 5852-5860 ◽

Cited By ~ 112

Author(s):

Frédérique Verdier ◽

Raquel Rabionet ◽

Fabrice Gouilleux ◽

Christian Beisenherz-Huss ◽

Paule Varlet ◽

...

Keyword(s):

Molecular Mechanisms ◽

Target Genes ◽

Prolactin Receptor ◽

Gene Promoter ◽

Expression Vectors ◽

Mobility Shift ◽

Nuclear Extracts ◽

Mobility Shift Assay ◽

Binding Sequence ◽

Biochemical Difference

ABSTRACT Two distinct genes encode the closely related signal transducer and activator of transcription proteins STAT5A and STAT5B. The molecular mechanisms of gene regulation by STAT5 and, particularly, the requirement for both STAT5 isoforms are still undetermined. Only a few STAT5 target genes, among them the CIS (cytokine-inducible SH2-containing protein) gene, have been identified. We cloned the human CIS gene and studied the human CIS gene promoter. This promoter contains four STAT binding elements organized in two pairs. By electrophoretic mobility shift assay studies using nuclear extracts of UT7 cells stimulated with erythropoietin, we showed that these four sequences bound to STAT5-containing complexes that exhibited different patterns and affinities: the three upstream STAT binding sequences bound to two distinct STAT5-containing complexes (C0 and C1) and the downstream STAT box bound only to the slower-migrating C1 band. Using nuclear extracts from COS-7 cells transfected with expression vectors for the prolactin receptor, STAT5A, and/or STAT5B, we showed that the C1 complex was composed of a STAT5 tetramer and was dependent on the presence of STAT5A. STAT5B lacked this property and bound with a stronger affinity than did STAT5A to the four STAT sequences as a homodimer (C0 complex). This distinct biochemical difference between STAT5A and STAT5B was confirmed with purified activated STAT5 recombinant proteins. Moreover, we showed that the presence on the same side of the DNA helix of a second STAT sequence increased STAT5 binding and that only half of the palindromic STAT binding sequence was sufficient for the formation of a STAT5 tetramer. Again, STAT5A was essential for this cooperative tetrameric association. This property distinguishes STAT5A from STAT5B and could be essential to explain the transcriptional regulation diversity of STAT5.

Download Full-text

Identification of the DNA Binding Sites of PerA, the Transcriptional Activator of the bfp and per Operons in Enteropathogenic Escherichia coli

Journal of Bacteriology ◽

10.1128/jb.185.9.2835-2847.2003 ◽

2003 ◽

Vol 185 (9) ◽

pp. 2835-2847 ◽

Cited By ~ 24

Author(s):

J. Antonio Ibarra ◽

Miryam I. Villalba ◽

José Luis Puente

Keyword(s):

Escherichia Coli ◽

Binding Sites ◽

Promoter Sequence ◽

Transcriptional Regulators ◽

Mobility Shift ◽

Dna Motifs ◽

Dnase I Footprinting ◽

Dna Binding Sites ◽

Important Virulence Factor ◽

Similar Affinity

ABSTRACT The bundle-forming pilus (BFP) is an important virulence factor for enteropathogenic Escherichia coli (EPEC). Genes involved in its biogenesis and regulation are tightly regulated by PerA (BfpT), a member of the AraC/XylS family of transcriptional regulators. The aim of this work was to purify PerA and determine its association with bfpA and perA (bfpT) regulatory regions by electrophoretic mobility shift and DNase I footprinting assays. PerA was purified as a maltose-binding protein (MBP) fusion, which was capable of complementing bfpA expression and which was able to restore the localized adherence phenotype of an EPEC perA mutant strain. Upstream of bfpA and perA, MBP-PerA recognized with similar affinity asymmetric nucleotide sequences in which a 29-bp-long AT-rich consensus motif was identified. These DNA motifs share 66% identity and were previously shown, by deletion analysis, to be involved in the PerA-dependent expression of both genes. Interestingly, in perA, this motif spans the sequence between positions −75 and −47, approximately one helix turn upstream of the −35 promoter sequence, while in bfpA, it spans the sequence between positions −83 and −55, approximately two helix turns upstream from the promoter. An additional PerA binding site was identified at the 5′ end of the bfpA structural gene, which was not required for its activation. Experiments with LexA-PerA fusions suggested that PerA acts as a monomer to activate the transcription of both perA and bfpA, in contrast to what has been documented for other members of this family of transcriptional regulators.

Download Full-text

Two conserved essential motifs of the murine immunoglobulin lambda enhancers bind B-cell-specific factors.

Molecular and Cellular Biology ◽

10.1128/mcb.12.1.309 ◽

1992 ◽

Vol 12 (1) ◽

pp. 309-320 ◽

Cited By ~ 16

Author(s):

C M Rudin ◽

U Storb

Keyword(s):

B Cell ◽

Mobility Shift ◽

Enhancer Activity ◽

Regulatory Domains ◽

Dnase I Footprinting ◽

Dna Binding Factors ◽

Candidate Protein ◽

Specific Factors ◽

Mobility Shift Assay ◽

Immunoglobulin Lambda

Two highly homologous enhancers associated with the two murine immunoglobulin lambda constant-region clusters were recently identified. In order to better understand the molecular basis for the developmental stage- and cell-type-restricted expression of lambda genes, we have undertaken an analysis of the putative regulatory domains of these enhancers. By using a combination of DNase I footprinting, electrophoretic mobility shift assay, and site-specific mutations, four candidate protein binding sites have been identified at analogous positions in both enhancers. A mutation of any of these sites decreases enhancer activity. Two of the sites, lambda A and lambda B, are essential for enhancer function, and both of these sites appear to bind both B-cell-specific and general factors. Nevertheless, isolated lambda A and lambda B sites show no evidence of inherent transactivating potential, alone or together, even when present in up to three copies. We suggest that the generation of transactivating signals from these enhancers may require the complex interaction of multiple B-cell-specific and nonspecific DNA-binding factors.

Download Full-text

GATA-1 binding to the alphaV promoter negatively regulates expression of the integrin alphaV subunit in human leukemic K562 cells.

Acta Biochimica Polonica ◽

10.18388/abp.2002_3817 ◽

2002 ◽

Vol 49 (1) ◽

pp. 19-28 ◽

Cited By ~ 1

Author(s):

Małgorzata Czyz ◽

Marta Stasiak ◽

Joanna Boncela ◽

Czesław S Cierniewsk

Keyword(s):

Vascular Endothelial Cells ◽

Gene Promoter ◽

K562 Cells ◽

Nuclear Extract ◽

Binding Activity ◽

Vascular Endothelial ◽

Mobility Shift ◽

Dnase I Footprinting ◽

Mobility Shift Assay ◽

Lower Expression

Recently we observed that the transcription factors Sp1 and Sp3 bind to the CTCCTCCTC sequence located between positions -194 and -172 of the alphaV promoter region and are directly involved in the regulation of transcriptional activity of the alphaV gene in human umbilical vascular endothelial cells (HUVECs) (Czyz & Cierniewski, 1999, Eur. J. Biochem. 265, 638). In this report we provide evidence that the GATA-1 factor regulates alphaV expression during differentiation of pluripotent K562 cells induced either by phorbol 12-myristate 13-acetate (PMA) or butyric acid (BA) through interaction with the GATA element in the alphaV gene promoter. DNase I footprinting analysis revealed that region -413 to -408, covering the GATA binding site, was protected by nuclear extract from K562 cells. There was no protection of this region by HUVEC nuclear extract. Electrophoretic mobility shift assay (EMSA) analysis of nuclear extract of K562 cells treated with BA revealed an increase in GATA binding activity, which was associated with reduced alphaV mRNA and alphaV protein on the cell surface. Stimulation of K562 cells with PMA resulted in opposite effects: lower expression of GATA-1 was associated with increased levels of alphaV. We conclude that the GATA-1 transcription factor specifically binds to the GATA element in the alphaV gene promoter and negatively regulates alphaV gene expression.

Download Full-text

The KH domain facilitates the substrate specificity and unwinding processivity of DDX43 helicase

Journal of Biological Chemistry ◽

10.1074/jbc.ra120.015824 ◽

2020 ◽

pp. jbc.RA120.015824

Author(s):

Manisha Yadav ◽

Ravi Shankar Singh ◽

Daniel Hogan ◽

Venkatasubramanian Vidhyasagar ◽

Shizhuo Yang ◽

...

Keyword(s):

Substrate Specificity ◽

Mutational Analysis ◽

Sequence Specificity ◽

Nucleic Acid Binding ◽

Mobility Shift ◽

Dead Box ◽

Kh Domain ◽

Mobility Shift Assay ◽

Exponential Enrichment ◽

Binding Sequence

The K-homology (KH) domain is a nucleic acid binding domain present in many proteins. Recently we found that the DEAD-box helicase DDX43 contains a KH domain in its N-terminus; however, its function remains unknown. Here, we purified recombinant DDX43 KH domain protein and found that it prefers binding single-stranded (ss)DNA and ssRNA. Electrophoretic mobility shift assay (EMSA) and nuclear magnetic resonance (NMR) revealed that the KH domain favors pyrimidines over purines. Mutational analysis showed that the GXXG-loop in the KH domain is involved in pyrimidine binding. Moreover, we found that an alanine residue adjacent to the GXXG loop is critical for binding. SELEX (systematic evolution of ligands by exponential enrichment), chromatin immunoprecipitation (ChIP)-seq, and crosslinking immunoprecipitation (CLIP)-seq showed that the KH domain binds C/T rich DNA and U rich RNA. Bioinformatics analysis suggested that the KH domain prefers to bind promoters. Using 15N-HSQC NMR, the optimal binding sequence was identified as TTGT. Finally, we found that the full-length DDX43 helicase prefers DNA or RNA substrates with TTGT or UUGU single strand tails, and that the KH domain is critically important for sequence specificity and unwinding processivity. Collectively, our results demonstrated that the KH domain facilitates the substrate specificity and processivity of the DDX43 helicase.

Download Full-text

Regulation ofperRExpression by Iron and PerR in Campylobacter jejuni

Journal of Bacteriology ◽

10.1128/jb.05493-11 ◽

2011 ◽

Vol 193 (22) ◽

pp. 6171-6178 ◽

Cited By ~ 17

Author(s):

Minkyeong Kim ◽

Sunyoung Hwang ◽

Sangryeol Ryu ◽

Byeonghwa Jeon

Keyword(s):

Oxidative Stress ◽

Campylobacter Jejuni ◽

Regulatory Region ◽

Transcriptional Level ◽

Mobility Shift ◽

Content Type ◽

Dnase I Footprinting ◽

Transcriptional Changes ◽

Electrophoretic Mobility Shift Assays ◽

Binding Sequence

Campylobacter jejuniis a leading food-borne pathogen causing gastroenteritis in humans. Although OxyR is a widespread oxidative stress regulator in many Gram-negative bacteria,C. jejunilacks OxyR and instead possesses the metalloregulator PerR. Despite the important role played by PerR in oxidative stress defense, little is known about the factors influencingperRexpression inC. jejuni. In this study, aperRpromoter-lacZfusion assay demonstrated that iron significantly reduced the level ofperRtranscription, whereas other metal ions, such as copper, cobalt, manganese, and zinc, did not affectperRtranscription. Notably, aperRmutation substantially increased the level ofperRtranscription and intranscomplementation restored the transcriptional changes, suggestingperRis transcriptionally autoregulated inC. jejuni. In theperRmutant, iron did not repressperRtranscription, indicating the iron dependence ofperRexpression results fromperRautoregulation. Electrophoretic mobility shift assays showed that PerR binds to theperRpromoter, and DNase I footprinting assays identified a PerR binding site overlapping the −35 region of the twoperRpromoters, further supportingperRautoregulation at the transcriptional level. Alignment of the PerR binding sequence in theperRpromoter with the regulatory region of other PerR regulon genes ofC. jejunirevealed a 16-bp consensus PerR binding sequence, which shares high similarities to theBacillus subtilisPerR box. The results of this study demonstrated that PerR directly interacts with theperRpromoter and regulatesperRtranscription and thatperRautoregulation is responsible for the repression ofperRtranscription by iron inC. jejuni.

Download Full-text

Characterization of LgnR, an IclR family transcriptional regulator involved in the regulation of l-gluconate catabolic genes in Paracoccus sp. 43P

Microbiology ◽

10.1099/mic.0.074286-0 ◽

2014 ◽

Vol 160 (3) ◽

pp. 623-634 ◽

Cited By ~ 7

Author(s):

Tetsu Shimizu ◽

Akira Nakamura

Keyword(s):

Constitutive Expression ◽

Transcriptional Regulator ◽

Pcr Analysis ◽

Mobility Shift ◽

Gene Encoding ◽

Reverse Transcription Pcr ◽

Dnase I Footprinting ◽

Catabolic Genes ◽

Genes Encoding ◽

Mobility Shift Assay

Five genes encoding enzymes required for l-gluconate catabolism, together with genes encoding components of putative ABC transporters, are located in a cluster in the genome of Paracoccus sp. 43P. A gene encoding a transcriptional regulator in the IclR family, lgnR, is located in front of the cluster in the opposite direction. Reverse transcription PCR analysis indicated that the cluster was transcribed as an operon, termed the lgn operon. Two promoters, P lgnA and P lgnR , are divergently located in the intergenic region, and transcription from these promoters was induced by addition of l-gluconate or d-idonate, a catabolite of l-gluconate. Deletion of lgnR resulted in constitutive expression of lgnA, lgnH and lgnR, indicating that lgnR encodes a repressor protein for the expression of the lgn operon and lgnR itself. Electrophoretic mobility shift assay and DNase I footprinting analyses revealed that recombinant LgnR binds to both P lgnA and P lgnR , indicating that LgnR represses transcription from these promoters by competing with RNA polymerase for binding to these sequences. d-Idonate was identified as a candidate effector molecule for dissociation of LgnR from these promoters. Phylogenetic analysis revealed that LgnR formed a cluster with putative proteins from other genome sequences, which is distinct from those proteins of known regulatory functions, in the IclR family of transcriptional regulators. Additionally, the phylogeny suggests an evolutionary linkage between the l-gluconate catabolic pathway and d-galactonate catabolic pathways distributed in Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria and Actinobacteria.

Download Full-text

LysR Family regulator LttR Controls Conjugated Linoleic Acid Production by Directly Activating the cla Operon in Lactobacillus plantarum

Applied and Environmental Microbiology ◽

10.1128/aem.02798-20 ◽

2021 ◽

Author(s):

Xin-Xin Liu ◽

Zhi-Qiang Xiong ◽

Guang-Qiang Wang ◽

Li-Feng Wang ◽

Yong-Jun Xia ◽

...

Keyword(s):

Lactobacillus Plantarum ◽

Regulatory Mechanism ◽

Transcriptional Regulator ◽

Fold Increase ◽

Regulatory Mechanisms ◽

Binding Motif ◽

Separation And Purification ◽

Dnase I Footprinting ◽

Acetoacetate Decarboxylase ◽

Lysr Family

Conjugated linoleic acids (CLA) have attracted more attention as functional lipids due to their potential physiological activities including anti-cancer, anti-inflammatory, anti-cardiovascular disease and anti-diabetes. Microbiological synthesis of CLA has become a compelling method due to its high isomer selectivity and convenient separation and purification process. In Lactobacillus plantarum, the generation of CLA from linoleic acids (LA) requires the combination of CLA oleate hydratase (CLA-HY), CLA short-chain dehydrogenase (CLA-DH) and CLA acetoacetate decarboxylase (CLA-DC) which are separately encoded by cla-hy, cla-dh and cla-dc. However, the regulatory mechanisms of CLA synthesis remain unknown. In this study, we found that a lysR-family transcriptional regulator LTTR directly bound to the promoter region of cla operon and activated the transcription of cla-dh and cla-dc. The binding motif was also predicted by bioinformatics analysis and verified by EMSA and DNase I footprinting assay. The lttR overexpression strain showed a 5-fold increase in CLA production. Moreover, we uncovered that the transcription of lttR is activated by LA. These results indicate that LttR senses LA and promotes CLA production by activating the transcription of cla-dh and cla-dc. This study reveals a new regulatory mechanism in CLA biotransformation and provides a new potential metabolic engineering strategy to increase the yield of CLA. Importance Our work has identified a novel transcriptional regulator LTTR that regulates the production of CLA by activating the transcription of cla-dh and cla-dc, essential genes participating in the CLA synthesis in Lactobacillus plantarum. This provides the insight into the regulatory mechanism of CLA synthesis and broadens our understanding about synthesis and regulatory mechanisms of biosynthesis of CLA.

Download Full-text