scholarly journals Thyroid Hormone Stimulates the Proliferation of Sertoli Cells and Single Type A Spermatogonia in Adult Zebrafish (Danio rerio) Testis

Endocrinology ◽  
2013 ◽  
Vol 154 (11) ◽  
pp. 4365-4376 ◽  
Author(s):  
R. D. V. S. Morais ◽  
R. H. Nóbrega ◽  
N. E. Gómez-González ◽  
R. Schmidt ◽  
J. Bogerd ◽  
...  
Keyword(s):  
Gene Expression ◽  
Tissue Culture ◽  
Thyroid Hormone ◽  
Sertoli Cells ◽  
Connexin 43 ◽  
Type A ◽  
Single Type ◽  
Mrna Levels ◽  
Adult Zebrafish ◽  
Androgen Sensitivity

Thyroid hormones participate in regulating growth and homeostatic processes in vertebrates, including development and adult functioning of the reproductive system. Here we report a new stimulatory role of thyroid hormone on the proliferation of Sertoli cells (SCs) and single, type A undifferentiated spermatogonia (Aund) in adult zebrafish testes. A role for T3 in zebrafish testis is suggested by in situ hybridization studies, which localized thyroid receptor α (thrα) in SCs and the β (thrβ) mRNA in Sertoli and Leydig cells. Using a primary zebrafish testis tissue culture system, the effect of T3 on steroid release, spermatogenesis, and the expression of selected genes was evaluated. Basal steroid release and Leydig cell gene expression did not change in response to T3. However, in the presence of FSH, T3 potentiated gonadotropin-stimulated androgen release as well as androgen receptor (ar) and 17α-hydroxylase/17,20 lyase (cyp17a1) gene expression. Moreover, T3 alone stimulated the proliferation of both SCs and Aund, potentially resulting in newly formed spermatogonial cysts. Additional tissue culture studies demonstrated that Igf3, a new, gonad-specific member of the IGF family, mediated the stimulatory effect of T3 on the proliferation of Aund and SCs. Finally, T3 induced changes in connexin 43 mRNA levels in the testis, a known T3-responsive gene. Taken together, our studies suggest that T3 expands the population of SCs and Aund involving Igf signaling and potentiates gonadotropin-stimulated testicular androgen production as well as androgen sensitivity.

scholarly journals Cloning, pharmacological characterization, and expression analysis of Atlantic salmon (Salmo salar L.) nuclear progesterone receptor

Reproduction ◽  
2011 ◽  
Vol 141 (4) ◽  
pp. 491-500 ◽  
Author(s):  
Shi X Chen ◽  
Jan Bogerd ◽  
Eva Andersson ◽  
Fernanda F L Almeida ◽  
Geir Lasse Taranger ◽  
...  
Keyword(s):  
Progesterone Receptor ◽  
Atlantic Salmon ◽  
Sertoli Cells ◽  
Plasma Levels ◽  
Type A ◽  
Mrna Levels ◽  
Early Type ◽  
Type B ◽  
Late Type ◽  
Nuclear Progesterone Receptor

To better understand the role(s) of progestogens during early stages of spermatogenesis, we carried out studies on the nuclear progesterone receptor (Pgr) of the Atlantic salmon. Its open-reading frame shows the highest similarity with other piscine Pgr proteins. When expressed in mammalian cells, salmon Pgr exhibited progestogen-specific, dose-dependent induction of reporter gene expression, with 17α,20β-dihydroxy-4-pregnen-3-one (DHP) showing the highest potency. We then analyzed testicular pgr mRNA and DHP plasma levels in animals during the onset of spermatogenesis, which were exposed to natural light or to constant light, to induce significant differences in testis growth. Grouping of the animals according to their progress through spermatogenesis showed that testicular pgr mRNA levels as well as DHP plasma levels first increased when germ cells had reached the stage of late type B spermatogonia and further increased when entered meiosis, i.e. when spermatocytes were present. However, in situ hybridization studies revealed that pgr mRNA expression was restricted to Sertoli cells, with a strong signal in Sertoli cells contacting type A/early type B spermatogonia, while Sertoli cells contacting larger germ cell clones with further differentiated stages (e.g. late type B spermatogonia) were less intensely/not stained. We conclude that the increase in pgr mRNA levels per pair of testis reflects, at least in part, the increased number of Sertoli cells enveloping type A and early type B spermatogonia. We propose that Sertoli cell-expressed Pgr may mediate DHP-stimulated early steps in spermatogenesis in Atlantic salmon, such as an increase in the number of new spermatogonial cysts.

scholarly journals Effect of retinoid status on α, β and γ retinoic acid receptor mRNA levels in various rat tissues

1992 ◽  
Vol 286 (3) ◽  
pp. 755-760 ◽  
Author(s):  
S Kato ◽  
H Mano ◽  
T Kumazawa ◽  
Y Yoshizawa ◽  
R Kojima ◽  
...  
Keyword(s):  
Gene Expression ◽  
Vitamin D ◽  
Retinoic Acid ◽  
Thyroid Hormone ◽  
Vitamin A ◽  
Retinoic Acid Receptor ◽  
Rat Tissues ◽  
Mrna Levels ◽  
Acid Receptor ◽  
Beta Gene

We have investigated the effects of retinoids, vitamin D and thyroid hormone on the levels of retinoic acid receptor (RAR)alpha, RAR beta and RAR gamma mRNAs in intact animals. Although vitamin A deficiency caused no significant changes in the levels of RAR alpha and RAR gamma mRNAs, the level of RAR beta transcripts was greatly decreased in various tissues of vitamin A-deficient rats, but was restored rapidly to a normal level after administration of retinoic acid. Retinol also restored the RAR beta mRNA level, but the magnitude and kinetics of the induction differed from those by retinoic acid. The use of specific inhibitors demonstrated that this autoregulation of RAR beta gene expression in vivo occurred at the transcriptional level. In addition, from these results it was postulated that the maintenance of the normal RAR beta mRNA levels seemed to require a threshold serum retinol concentration (about 25 micrograms/dl). Moreover, we found that administration of retinol and retinoic acid to normal rats caused the overexpression of RAR beta transcripts (2-15-fold) when compared with the control levels of RAR beta mRNA, although the levels of RAR alpha and RAR gamma mRNAs were not affected. Vitamin D and thyroid hormone did not modulate the levels of RAR transcripts. These findings clearly indicate the specific ligand regulation of RAR beta gene expression in intact animals. The altered levels of RAR beta according to retinoid status may affect retinoid-inducible gene expression.

Negative regulation of the rat Na-K-ATPase alpha 3-subunit gene promoter by thyroid hormone

1996 ◽  
Vol 271 (5) ◽  
pp. C1750-C1756 ◽  
Author(s):  
H. He ◽  
S. Chin ◽  
K. Zhuang ◽  
R. Hartong ◽  
J. Apriletti ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Cardiac Myocytes ◽  
Reporter Gene ◽  
Reporter Gene Expression ◽  
Neonatal Rat ◽  
Proximal Promoter ◽  
Mrna Levels ◽  
Neonatal Rat Cardiac Myocytes ◽  
Rat Cardiac Myocytes

Na-K-ATPase alpha 3-subunit mRNA levels are both positively and negatively controlled by thyroid hormone [3,5,3'triiodothyronine (T3)] in primary cultures of neonatal rat cardiac myocytes. In this study, transient transfection analysis indicated that two regions of the rat alpha 3 gene between nucleotides -116 and -6 and -6 and +80 conferred T3-mediated inhibition of reporter gene expression. Electrophoretic mobility shift assays showed specific binding of T3 receptor monomers and T3 receptor-retinoid X receptor heterodimers at each alpha 3 gene negative T3-response region. The alpha 3 gene region from -116 to -6 base pairs also mediates repression in response to retinoic acid (RA) and binds RA receptor. In the absence of ligand, reporter gene expression driven by the -116 to -6-base pair region is repressed with cotransfection of T3 receptor, whereas it is unaffected by overexpression of RA receptor. These data demonstrate that the proximal promoter of the rat Na-K-ATPase alpha 3 gene contains sequence motifs that mediate repression of alpha 3 gene transcription in response to either T3 or RA in neonatal rat cardiac myocytes.

scholarly journals Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Endocrinology ◽  
2006 ◽  
Vol 147 (9) ◽  
pp. 4292-4302 ◽  
Author(s):  
Koshi Hashimoto ◽  
Masanobu Yamada ◽  
Shunichi Matsumoto ◽  
Tsuyoshi Monden ◽  
Teturou Satoh ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Retinoid X Receptor ◽  
Mrna Levels ◽  
Response Element ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

scholarly journals Thyroid hormone effects on androgen receptor messenger RNA expression in rat Sertoli and peritubular cells

1998 ◽  
Vol 156 (1) ◽  
pp. 43-50 ◽  
Author(s):  
NK Arambepola ◽  
D Bunick ◽  
PS Cooke
Keyword(s):  
Androgen Receptor ◽  
Thyroid Hormone ◽  
Mrna Expression ◽  
Sertoli Cell ◽  
Sertoli Cells ◽  
Mrna Levels ◽  
Serum Free Medium ◽  
Free Medium ◽  
Serum Free ◽  
Peritubular Cells

Postnatal Sertoli cell maturation is characterized by a pronounced rise in androgen receptor (AR) expression, which increases several fold between birth and adulthood. Since both 3,3',5-triiodothyronine (T3) and FSH regulate Sertoli cell proliferation and differentiation, we have determined the effects of T3 and FSH on AR mRNA expression in cultured Sertoli cells from 5-day-old rats. These cultures contain 5-9% peritubular cells, which also express AR mRNA. To insure that the observed T3 responses did not result from peritubular cells, we examined T3 effects on AR mRNA expression in cultured 20-day-old Sertoli cells (which contain minimal peritubular contamination) and peritubular cells, and measured thyroid hormone receptor (TR) mRNA expression in both of these cell types. Sertoli cells from 5- and 20-day-old rat testes were grown in serum-free medium alone (controls) or with ovine FSH (100 ng/ml) and/or T3 (100 nM) for 4 days. Peritubular cells purified from 20-day-old rat testes were grown in serum-containing medium for 8 days. These cells were split 1:4, and grown an additional 8 days, the last 4 days in serum-free medium with or without T3. TR and AR mRNA levels in all cultures were determined by Northern blotting. AR mRNA levels in 5- and 20-day-old cultured Sertoli cells were significantly (P < 0.05) increased by both T3 and FSH alone. Furthermore, AR mRNA levels in Sertoli cells treated with T3 and FSH were greater than with either alone. TR mRNA expression was detected in cultured peritubular cells, but TR mRNA levels in these cells were only approximately 30% of that seen in 20-day-old cultured Sertoli cells. In contrast to Sertoli cells, T3 did not affect peritubular AR mRNA expression. These results indicate that T3 is an important regulator of the postnatal Sertoli cell AR mRNA increase. The additive effects of maximally stimulatory doses of FSH and T3 suggest these hormones work through different mechanisms to increase AR mRNA. TR mRNA expression in peritubular cells indicates these cells may be direct T3 targets, though the function of T3 in these cells is unknown.

scholarly journals SAT-441 Transcriptome Analysis Under Differential Thyroid Hormone Treatment During Mouse Cerebellar Development

2020 ◽  
Vol 4 (Supplement_1) ◽  
Author(s):  
Hiroyuki Yajima ◽  
Ishii Sumiyasu ◽  
Wataru Miyazaki ◽  
Noriyuki Koibuchi
Keyword(s):  
Gene Expression ◽  
Transcriptional Regulation ◽  
Thyroid Hormone ◽  
Target Genes ◽  
Expression Profiles ◽  
Gene Expression Profiles ◽  
Hormone Treatment ◽  
Cerebellar Development ◽  
Mrna Levels ◽  
Dependent Manner

Abstract Background: Thyroid hormone (TH) plays essential roles in the development of the cerebellum by regulating transcription of target genes. TH binds to TH receptor (TR) located in the cell nucleus and stimulates transcription through TH response element (TRE). The expression of many genes is temporary and spatially regulated by TH during cerebellar development. However, the mode of transcription by TR may vary among target genes. In the liver, different duration of TH exposure resulted in distinct gene expression profiles. To examine the mechanisms of transcriptional regulation by TH in cerebellar development, gene expression profile induced by various TH exposure duration was studied. Methods: Anti-thyroid drug propylthiouracil (250 ppm in drinking water) was administered to C57BL/6J mice from the gestational day 14 to postnatal day (P) 7 to generate perinatal hypothyroid mice. To study the effect of continuous TH exposure, TH was subcutaneously administered to hypothyroid pups from P2 to P7 (6 days group). To study the effect of single TH administration, TH was injected on P7 and mice were sacrificed either 6 (6 hours group) or 24 hours (24 hours group) after injection. Cerebellar samples were collected to extract RNA and subject to microarray analysis. Microarray results were confirmed by RT-qPCR. Results: In microarray result, compared with mRNA levels of hypothyroid mice, 6 days group induced upregulation in 1007 genes and downregulation in 1009 genes, 6 hours group induced upregulation in 355 genes and downregulation in 977 genes, and 24 hours group induced upregulation in 365 genes and downregulation in 1121 genes. Only 7.6% of the genes were overlapped in three groups among positively regulated genes. In contrast, 57.2% of the genes were common in the negatively regulated genes. In RT-qPCR result, among genes known to harbor TRE, Hairless, Pcp2, and Nrgn, showed differential upregulation patterns. Hairless was upregulated in all groups, whereas Pcp2 was upregulated only in 5 days group and Nrgn was not upregulated in all groups. These results suggest that different mode of transcriptional regulation occurred in an exposure time-dependent manner of TH. Conclusion: We identified gene groups whose expression were modified by TH during cerebellar development. TH distinctively regulates transcription of target genes depending on the exposure schedule in mouse developing cerebellum.

116 Differential expression of connexin 43 and 37 mRNA transcripts during the estrous cycle in canines

2019 ◽  
Vol 31 (1) ◽  
pp. 184
Author(s):  
M. De los Reyes ◽  
J. Palomino ◽  
R. Espinoza ◽  
C. Gallego
Keyword(s):  
Gene Expression ◽  
Gap Junctions ◽  
Corpus Luteum ◽  
Connexin 43 ◽  
Expression Patterns ◽  
Rna Extraction ◽  
Follicular Development ◽  
Oestrous Cycle ◽  
Mrna Levels ◽  
Follicular Cells

Gap junctions are intercellular channels that mediate cell-to-cell communication, allowing the passage of small signalling molecules. In the ovary, connexin 43 (Cx43) and connexin 37 (Cx37) are important gap junctional proteins expressed in the granulosa and cumulus cells or oocytes of several species. Gap junctions and connexins are required for the regulation of the oocytes meiotic resumption in preovulatory follicles after the surge of LH. However, unlike other species, canine oocytes do not resume meiosis before ovulation, which could be related to expression patterns of Cx43 and Cx37 during oocyte development and ovulation. Therefore, this study aimed to address the canine Cx37 and Cx43 gene expressions throughout the oestrous cycle, including the preovulatory period. The ovaries were obtained from bitches 1-6 years old (n=72) following ovariohysterectomy. The stage of the oestrous cycle was assessed according the ovarian structures and by measurements of serum progesterone (P4) levels obtained from blood samples on the day of surgery. Anestrus was &lt;0.1 ng/mL P4 and absence of follicles or corpus luteum in the ovarian surface; proestrus was 0.2-2 ng/mL P4 and growing small to medium follicles on the surface of the ovaries; oestrus was 2-19 mg/mL P4 and large follicles on the surface of the ovaries; and diestrus was &gt;20 ng/mL P4 and mainly predominant corpus luteum on the ovaries. For Cx43 analysis, follicular cells (granulosa and theca) were mechanically recovered from follicles (n=620) distributed into 4 types: prenatal (1 layer of granulosa cells up to the onset of antrum formation), small antral (~0.2-0.39mm), medium antral (~0.4-5.9mm), and large antral (~6-10mm). For Cx37 study, the cumulus-oocytes complexes (COC) from the same follicles were used. Total RNA extraction was performed, and the evaluation of gene expression levels was achieved by relative quantification quantitative PCR analysis in follicular cells and COC. The data from at least 3 independent experiments for each gene were evaluated by ANOVA. The gene expression of both Connexins were observed in all stages of follicular development; however, the mRNA levels varied over the oestrous cycle. Both Cx43 and Cx37 transcripts showed the highest (P&lt;0.05) levels at anestrus when compared to other phases. The mRNA levels of both genes remained without changes in large follicles at oestrus stage, suggesting that, in contrast to other mammals where LH down-regulates connexins expression leading to the subsequent loss of intercellular coupling, the communication between the oocyte and follicular cells was maintained in canines. In conclusion, these 2 connexin genes were differentially expressed in canine follicular cells and COC during the follicular development. The maintenance of the gene expression of these connexins at the final follicular growth may be involved in the prolonged meiotic arrest in this species. Supported by Ga grant from FONDECYT (1171670).

scholarly journals Thyroid hormone stimulation of osteocalcin gene expression in ROS 17/2.8 cells is mediated by transcriptional and post-transcriptional mechanisms

2001 ◽  
Vol 170 (3) ◽  
pp. 667-675 ◽  
Author(s):  
CH Gouveia ◽  
JJ Schultz ◽  
AC Bianco ◽  
GA Brent
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Cell Density ◽  
Half Life ◽  
Bone Development ◽  
Mrna Levels ◽  
Hormone Regulation ◽  
Dose Time ◽  
Mrna Induction ◽  
Run Off

We investigated the mechanism of thyroid hormone regulation of osteocalcin (OC) gene expression in osteoblast-like cells (ROS 17/2.8). Treatment with tri-iodothyronine (T3) (10(-8) M) increased OC mRNA levels by approximately 3-fold after 24 h and reached a maximum, approximately 5.4-fold, after 48 h. The mRNA levels of other bone-specific genes, alkaline phosphatase and osteopontin, were not affected by T3 treatment. Interestingly, T3 induction of OC mRNA varied according to cell density: approximately 4-fold at approximately 1x10(5) cells/dish and 1.5-fold at 40-60x10(5) cells/dish. The magnitude of OC mRNA induction by T3 was approximately 40% lower than induction by 1,25 dihydroxyvitamin D3 (1,25D3) alone, and the combination of T3+1,25D3 did not further stimulate OC mRNA levels. T3 induction of OC mRNA was not affected by treatment with cycloheximide (10 microg/ml) for 5 h indicating that new protein synthesis is not required for the response. To study the half-life of OC mRNA, ROS 17/2.8 cells were incubated with actinomycin D. The basal half-life of OC mRNA (means+/-s.e.m.) was 6.4+/-0.2 h which was increased significantly with either T3 or 1,25D3 treatment to 10.9+/-0.6 h and 13.5+/-0.4 h respectively. T3 modestly up-regulated the rate of OC gene transcription (1.7+/-0.2-fold) as determined by run-off assay. T3 did not induce a reporter construct containing the rat OC gene (rOC) 5'-flanking region (to -1750 bp) or the previously described rOC vitamin D response element, when transfected into ROS 17/2.8 cells. In conclusion, T3 up-regulates the OC mRNA expression in ROS 17/2.8 cells in a dose-, time- and cell confluence-dependent fashion, and does so by transcriptional and post-transcriptional mechanisms. The greater T3 induction of OC expression in ROS 17/2.8 cells at low cell density is consistent with findings of thyroid hormone action on bone development.

scholarly journals Liver X Receptor-α Gene Expression Is Positively Regulated by Thyroid Hormone

Endocrinology ◽  
2007 ◽  
Vol 148 (10) ◽  
pp. 4667-4675 ◽  
Author(s):  
Koshi Hashimoto ◽  
Shunichi Matsumoto ◽  
Masanobu Yamada ◽  
Teturou Satoh ◽  
Masatomo Mori
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Mrna Expression ◽  
Cross Talk ◽  
Promoter Activity ◽  
Gene Promoter ◽  
Retinoid X Receptor ◽  
Transcriptional Level ◽  
Mrna Levels ◽  
Transcription Analysis

The nuclear oxysterol receptors, liver X receptors (LXRs), and thyroid hormone receptors (TRs) cross talk mutually in many aspects of transcription, sharing the same DNA binding site (direct repeat-4) with identical geometry and polarity. In the current study, we demonstrated that thyroid hormone (T3) up-regulated mouse LXR-α, but not LXR-β, mRNA expression in the liver and that cholesterol administration did not affect the LXR-α mRNA levels. Recently, several groups have reported that human LXR-α autoregulates its own gene promoter through binding to the LXR response element. Therefore, we examined whether TRs regulate the mouse LXR-α gene promoter activity. Luciferase assays showed that TR-β1 positively regulated the mouse LXR-α gene transcription. Analysis of serial deletion mutants of the promoter demonstrated that the positive regulation by TR-β1 was not observed in the −1240/+30-bp construct. EMSA(s) demonstrated that TR-β1 or retinoid X receptor-α did not bind to the region from −1300 to −1240 bp (site A), whereas chromatin-immunoprecipitation assays revealed that TR-β1 and retinoid X receptor-α were recruited to the site A, indicating the presence of intermediating protein between the nuclear receptors and DNA site. We also showed that human LXR-α gene expression and promoter activities were up-regulated by thyroid hormone. These data suggest that LXR-α mRNA expression is positively regulated by TR-β1 and thyroid hormone at the transcriptional level in mammals. This novel insight that thyroid hormone regulates LXR-α mRNA levels and promoter activity should shed light on a cross talk between LXR-α and TR-β1 as a new therapeutic target against dyslipidemia and atherosclerosis.

Thyroid hormone-induced stimulation of the sarcoplasmic reticulum Ca2+ ATPase gene is inhibited by LIF and IL-6

2000 ◽  
Vol 278 (4) ◽  
pp. E738-E743 ◽  
Author(s):  
Bernd Gloss ◽  
Sonia Villegas ◽  
Francisco J. Villarreal ◽  
Anselmo Moriscot ◽  
Wolfgang H. Dillmann
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Sarcoplasmic Reticulum ◽  
Cardiac Myocytes ◽  
Transcriptional Activity ◽  
Neonatal Rat ◽  
Mrna Levels ◽  
Cytokine Inhibition ◽  
Atpase Gene ◽  
Promoter Construct

We investigated the effects of the leukemia inhibitory factor (LIF) and interleukin-6 (IL-6) on 3,3′, 5-triiodo-l-thyronine, or thyroid hormone (T3)-stimulated sarcoplasmic reticulum Ca2+ATPase (SERCA2) gene expression on cultured neonatal rat cardiac myocytes. A reduction of T3 induced increases in SERCA2 mRNA levels after co-treatment with LIF or IL-6. To investigate for the molecular mechanism(s) responsible for the blunted gene expression, a 3.2-kb SERCA2 promoter construct containing a reporter gene was transfected into cardiac myocytes. T3 treatment stimulated transcriptional activity twofold, whereas co-treatment with T3 and either of the cytokines caused an inhibition of T3-induced SERCA2 transcriptional activity. A T3-responsive 0.6-kb SERCA2 construct also showed a similar inhibition by cytokines. Cytokine inhibition of SERCA2 transcriptional activity was also evident when a 0.6-kb SERCA2 mutant, T3-unresponsive promoter construct was used. Treatment with T3 and cytokines showed a significant decrease in transcription when a reporter construct was used that was comprised of direct repeats of SERCA2 thyroid response element I. These data provide evidence for cytokine-mediated inhibitory effects on the SERCA2 promoter that may be mediated by interfering with T3action.

Sign in / Sign up

Export Citation Format

Share Document