scholarly journals Assessment of the Potential of Eco-Friendly Nematicides in the Management of Root-Knot Nematodes on French Beans in Kenya

2019 ◽  
Vol 7 (1) ◽  
pp. 62-67
Author(s):  
E. O. Ogumo ◽  
W. M. Muiru ◽  
J. W. Kimenju ◽  
D. M. Mukunya
Keyword(s):  
Reproductive Potential ◽  
Negative Control ◽  
French Bean ◽  
Economic Losses ◽  
Root Knot Nematode ◽  
Population Densities ◽  
Root Knot Nematodes ◽  
French Beans ◽  
Wide Range ◽  
Significant Difference

Root-knot nematodes (RKN) (Meloidogyne spp) are a serious pest causing heavy economic losses in a wide range of agricultural crops. A trial was carried out to evaluate the effectiveness of various eco-friendly nematicides in the management of RKN affecting French bean. The field trial was carried out in two seasons with the following treatments; Rigel-G (salicylic acid), Phyto Protect (Sesame oil extract), Mytech (Paecilomyces lilacinus), Neemraj 0.3% (Azadirachtin), Vydate® (Oxamyl) as a positive control and an untreated control. Various rates; Rigel –G (2.5 ml/l), Phyto Protect (10 l/ha), Mytech (125 g/ha) Neemraj 0.3% (3L/ha) and Vydate® (6 l/ha) of treatments were administered and damage on plants was assessed based on galling indices, crop biomass and yield whereas nematode reproductive potential was assessed based on the J2 counts. There was no significant difference (P ≥ 0.05) in the nematode population densities and galling indices observed among the eco-friendly nematicides and the conventional nematicide (Vydate®). Eco-friendly nematicides had a significant (P ≤ 0.05) reduction of RKN J2 population densities compared to the negative control. The negative control had the highest mean of root-knot nematode densities (240 RKN/200 cc soil) and a galling index of 3.77 while Vydate and Neemraj had the lowest mean density (40 RKN/200 cc soil) in the first season. Similar results were observed in the second season with control having the highest RKN J2 population densities (285 RKN/200 cc soil) and a galling index of 3.89 and Vydate had the lowest (23 RKN/200 cc soil). The results of this study clearly indicate that eco-friendly nematicides can be fully adopted to suppress RKN in French beans as alternatives to conventional nematicides.

scholarly journals Efficacy of Neem, Tithonia and Tephrosia Leaf Extracts in Management of Root-Knot Nematodes in French Beans (Phaseolus vulgaris L.)

2019 ◽  
Vol 7 (2) ◽  
pp. 240
Author(s):  
Joshua K. Njenga ◽  
Geofrey K. Gathungu ◽  
Jesca N. Mbaka
Keyword(s):  
Block Design ◽  
Field Trials ◽  
Positive Control ◽  
French Bean ◽  
Root Knot Nematode ◽  
Smallholder Farming ◽  
Leaf Extracts ◽  
Root Knot Nematodes ◽  
French Beans ◽  
Concentration Levels

Root-knot nematodes (Meloidogyne spp.) are a major problem in French bean production within the smallholder farming systems. Control of root-knot using synthetic nematicides is not viable due to environmental concerns relating to their toxic residues. There is need to develop alternative control options that will promote soil health and reduce parasitic nematode densities. A study was conducted to determine the efficacy of Neem (Azadirachta indica A. Juss), Tithonia (Tithonia diversifolia) and Tephrosia (Tephrosia purpurea) leaf extracts in management of root-knot. Controlled lath house and field trials were conducted where the treatments were extracts from Neem, Tithonia and Tephrosia at different concentration levels of 25 ml/L, 50 ml/L and 100 ml/L). Vydate (Oxamyl 10%) a synthetic nematicide served as a standard positive control while treatments with no extracts application and no nematode application served as negative controls. The treatments in the lath house were arranged in completely randomized design while the field trials were arranged in randomized complete block design. Fench beans were planted on nematode infested soils and data on root galling indices and yield components was collected. Data collected was subjected to analysis of variance and significantly different means separated using Tukey’s Studentized Range Test at P=0.05. The extracts evaluated reduced root galling with their efficacy being similar to that of Vydate® (Oxamyl 10%) which was used as a positive control. Neem extracts treatments had the lowest mean galling index of the extracts, followed by Tithonia. Root-knot nematode galling indices were highest in the untreated control at 10 both in trial I and trial II. Treatment trials from Neem and Tithonia at concentration levels of 100 ml/L resulted in highest yield of French beans while yield from the untreated plants were the lowest. The results indicate extracts can be adopted to suppress root-knot nematodes.

Rapid and visual detection of Meloidogyne hapla using recombinase polymerase amplification combined with a lateral flow dipstick (RPA-LFD) assay

Plant Disease ◽  
2020 ◽  
Author(s):  
Zhiqiang Song ◽  
Xiai Yang ◽  
Xiaowei Zhang ◽  
Mingbao Luan ◽  
Bing Guo ◽  
...  
Keyword(s):  
Rapid Detection ◽  
Lateral Flow ◽  
Recombinase Polymerase Amplification ◽  
Economic Losses ◽  
Meloidogyne Hapla ◽  
Root Knot Nematode ◽  
Resource Limited ◽  
Lateral Flow Dipstick ◽  
Wide Range ◽  
And Control

The northern root-knot nematode, Meloidogyne hapla, is a biotrophic parasite that infects many crops and causes severe economic losses worldwide. Rapid and accurate detection of M. hapla is crucial for disease forecasting and control. We developed a recombinase polymerase amplification combined with a lateral flow dipstick (RPA-LFD) assay for rapid detection of M. hapla. The primers and a probe were designed based on the effector gene 16D10 sequence and were highly specific to M. hapla. The RPA reaction was performed at a wide range of temperatures from 25 to 45°C within 5 to 25 min, and the amplicon was visualized directly on the LFD within 5 min. The detection limits of the RPA-LFD assay were 10-3 female and 10-2 J2/0.5 g of soil, which was 10 times more sensitive than the conventional PCR assay. In addition, the RPA-LFD assay can detect M. hapla from infested plant roots and soil samples, and the entire detection process can be completed within 1.5 h. These results indicate that the RPA-LFD assay is a simple, rapid, specific, sensitive, and visual method that can be used for rapid detection of M. hapla in the field and in resource-limited conditions.

scholarly journals Cleaved CD31 as a target for in vivo molecular imaging of inflammation

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
Jonathan Vigne ◽  
Sylvie Bay ◽  
Rachida Aid-Launais ◽  
Guillaume Pariscoat ◽  
Guillaume Rucher ◽  
...  
Keyword(s):  
Molecular Imaging ◽  
Molecular Form ◽  
Positive Control ◽  
Negative Control ◽  
Stability Study ◽  
Biodistribution Studies ◽  
Wide Range ◽  
Significant Difference

AbstractThere is a need for new targets to specifically localize inflammatory foci, usable in a wide range of organs. Here, we hypothesized that the cleaved molecular form of CD31 is a suitable target for molecular imaging of inflammation. We evaluated a bioconjugate of D-P8RI, a synthetic peptide that binds all cells with cleaved CD31, in an experimental rat model of sterile acute inflammation. Male Wistar rats were injected with turpentine oil into the gastrocnemius muscle two days before 99mTc-HYNIC-D-P8RI (or its analogue with L-Proline) SPECT/CT or [18F]FDG PET/MRI. Biodistribution, stability study, histology, imaging and autoradiography of 99mTc-HYNIC-D-P8RI were further performed. Biodistribution studies revealed rapid elimination of 99mTc-HYNIC-D-P8RI through renal excretion with almost no uptake from most organs and excellent in vitro and in vivo stability were observed. SPECT/CT imaging showed a significant higher 99mTc-HYNIC-D-P8RI uptake compared with its analogue with L-Proline (negative control) and no significant difference compared with [18F]FDG (positive control). Moreover, autoradiography and histology revealed a co-localization between 99mTc-HYNIC-D-P8RI uptake and inflammatory cell infiltration. 99mTc-HYNIC-D-P8RI constitutes a new tool for the detection and localization of inflammatory sites. Our work suggests that targeting cleaved CD31 is an attractive strategy for the specific in vivo imaging of inflammatory processes.

scholarly journals First Report of the Root-Knot Nematode, Meloidogyne hispanica, Infecting Sunflower in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 703-703 ◽  
Author(s):  
E. A. Tzortzakakis ◽  
A. I. Anastasiadis ◽  
K. B. Simoglou ◽  
C. Cantalapiedra-Navarrete ◽  
J. E. Palomares-Rius ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Original Description ◽  
Economic Losses ◽  
State University ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
First Report ◽  
North Carolina State University ◽  
Helianthus Annus ◽  
Prunus Spp

Severe plant stunting, chlorosis, and extensive root galling were observed on sunflower (Helianthus annus Pioneer Hi-bred PR64LE19, Dupont) in a commercial field at Agios Athanasios, Drama Province, northeastern Greece at the end of May 2013. Disease symptoms were observed about 1.5 months after planting, and were distributed in patches that covered approximately 2% of the whole cultivated area. Examination of the soil and root samples from selected infected plants revealed the presence of abundant root-knot nematodes. Juveniles, males, and females were extracted by sieving, decanting, and root dissection for identification using morphological traits. Nematode population densities ranging from 100 to 150 J2s per 100 cm3 of soil, and 150 to 3,000 eggs per g of fresh sunflower roots were observed. Identification was confirmed by perineal patterns of females and by sequencing of the D2-D3 expansion segments of 28S ribosomal RNA gene (1,3,4). All identification methods were consistent with typical Meloidogyne hispanica. Morphology of perineal patterns of females and measurements of the second-stage juveniles (J2s) matched those of the original description of M. hispanica (3). Alignment indicated that the D2-D3 sequence (GenBank Accession No. KF501128) was 99% homologous to other sequences of M. hispanica deposited in GenBank from Brazil, Portugal, and Spain (EU443606, EU443608, and GQ375158, respectively), differing in only one nucleotide. Phylogenetic analyses using maximum likelihood of this sequence placed the Meloidogyne sp. in a highly supported (100%) clade that included all M. hispanica sequences available from the GenBank database (4). Root-knot nematodes in general have been reported to cause economic losses in sunflower in Europe (2), but there are no reports of M. hispanica. M. hispanica was first found in Seville Province, southern Spain, infecting rootstocks of Prunus spp. (3). Its distribution has been confirmed worldwide on different agricultural crops. However, to our knowledge, this is the first report of M. hispanica infecting sunflower in Europe and the first report of this species on any crop for Greece. The identification of M. hispanica in sunflower is relevant because it may represent a threat for sunflower production in Greece. Research to develop sunflower varieties resistant to root-knot nematodes should now also consider M. hispanica along with other species of Meloidogyne. References: (1) K. R. Barker. Page 19 in: An Advanced Treatise on Meloidogyne. Vol. II, Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh, NC, 1985. (2) M. Di Vito et al. Nematol. Mediterr. 24:109, 1996. (3) H. Hirschmann. J. Nematol. 18:520, 1986. (4) B. B. Landa et al. Plant Dis. 92:1104, 2008.

scholarly journals Mycotoxin Profile and Phylogeny of Pathogenic Alternaria Species Isolated from Symptomatic Tomato Plants in Lebanon

Toxins ◽  
2021 ◽  
Vol 13 (8) ◽  
pp. 513
Author(s):  
Wassim Habib ◽  
Mario Masiello ◽  
Romy El Ghorayeb ◽  
Elvis Gerges ◽  
Antonia Susca ◽  
...  
Keyword(s):  
Fungal Pathogens ◽  
Reference Strain ◽  
Animal Health ◽  
Economic Losses ◽  
Pathogenicity Test ◽  
Tenuazonic Acid ◽  
Tomato Plants ◽  
Wide Range ◽  
Significant Difference ◽  
Alternaria Species

The tomato is one of the most consumed agri-food products in Lebanon. Several fungal pathogens, including Alternaria species, can infect tomato plants during the whole growing cycle. Alternaria infections cause severe production and economic losses in field and during storage. In addition, Alternaria species represent a serious toxicological risk since they are able to produce a wide range of mycotoxins, associated with different toxic activities on human and animal health. Several Alternaria species were detected on tomatoes, among which the most important are A. solani, A. alternata, and A. arborescens. A set of 49 Alternaria strains isolated from leaves and stems of diseased tomato plants were characterised by using a polyphasic approach. All strains were included in the recently defined phylogenetic Alternaria section and grouped in three well-separated sub-clades, namely A. alternata (24 out of 49), A. arborescens (12 out of 49), and A. mali morpho-species (12 out of 49). One strain showed high genetic similarity with an A.limoniasperae reference strain. Chemical analyses showed that most of the Alternaria strains, cultured on rice, were able to produce alternariol (AOH), alternariol methyl ether (AME), altenuene (ALT) and tenuazonic acid (TA), with values up to 5634, 16,006, 5156, and 4507 mg kg−1, respectively. In addition, 66% of the strains were able to co-produce simultaneously the four mycotoxins investigated. The pathogenicity test carried out on 10 Alternaria strains, representative of phylogenetic sub-clades, revealed that they were all pathogenic on tomato fruits. No significant difference among strains was observed, although A. alternata and A. arborescens strains were slightly more aggressive than A. mali morpho-species strains. This paper reports new insights on mycotoxin profiles, genetic variability, and pathogenicity of Alternaria species on tomatoes.

A disease of French beans (Phaseolus vulgaris L.) caused by subterranean clover stunt virus

1966 ◽  
Vol 17 (6) ◽  
pp. 875 ◽  
Author(s):  
PR Smith
Keyword(s):  
Field Tests ◽  
Subterranean Clover ◽  
French Bean ◽  
French Beans ◽  
Whole Plant ◽  
Subterranean Clover Stunt Virus ◽  
Wide Range ◽  
Aphis Craccivora Koch ◽  
Aphid Inoculation ◽  
High Degree

A disease causing serious crop losses in early-sown French beans in the East Gippsland area of Victoria has been shown to be caused by subterranean clover stunt virus. The virus infected a wide range of leguminous plants and persisted through a moult of its principal vector, Aphis craccivora Koch. It was not seed-borne, nor was it mechanically transmissible. The field symptoms of the disease on French beans consisted of chlorosis and epinasty of leaves, the whole plant being markedly stunted with a reduction in the length of the internodes. These symptoms were reproduced in the glasshouse by aphid inoculation of the virus to French beans. However, the virus was recovered from both naturally infected and artificially inoculated beans with difficulty. In field tests, no cultivar of French bean tested was immune to the virus, although a high degree of tolerance was observed in the cultivars Red Mexican U.I.3, U.I.34, and U.I.37, and Pinto U.I.72 and U.I.78.

scholarly journals Effect of some rhizosphere bacteria on root-knot nematodes

2020 ◽  
Vol 30 (1) ◽  
Author(s):  
Ghena Mamdouh AbdelRazek ◽  
Rabaa Yaseen
Keyword(s):  
Growth Parameters ◽  
Low Cost ◽  
Pseudomonas Stutzeri ◽  
Rhizosphere Bacteria ◽  
Rrna Gene ◽  
Main Body ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
Final Population ◽  
Wide Range

Abstract Background Root-knot nematodes are among the world’s most damaging endoparasitic sedentary nematodes, especially, Meloidogyne incognita that infects a wide range of plant hosts. The activity of different antagonistic bacteria was studied for the low-cost and eco-friendly management of M. incognita on eggplant. Main body Twenty-five isolates were isolated from rhizosphere soils infected with nematodes. Of these, 6 isolates displayed the highest activity, demonstrating 100% mortality of J2 nematodes under laboratory conditions. Partial sequencing of 16S rRNA gene and phylogenetic analysis was used to identify the selected isolates and they were found to be Paenibacillus amylolyticus, Brevibacillus agri, Gluconobacter frateurii, Beijerinckia mobilis, Achromobacter aloeverae, and Pseudomonas stutzeri. The abilities of the selected isolates to produce hydrogen cyanide, siderophores, chitinase, protease, indole acetic acid, and to dissolve phosphorus were also detected. Conclusion The results of the greenhouse experiment indicated that all the tested bacteria had a greatly significant effectiveness for suppressing root-knot nematode M. incognita. Application of all the rhizosphere bacteria and their combinations reduced the number of galls, number of juveniles, egg-masses, eggs, females, and total final population. All bio-agent treatments succeeded in improving the plant growth parameters and increased the microbial density in eggplant rhizosphere.

scholarly journals First Report of Meloidogyne graminicola Infecting Banana in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 420-420 ◽  
Author(s):  
X. Zhou ◽  
G. K. Liu ◽  
S. Xiao ◽  
S. S. Zhang
Keyword(s):  
Natural Infection ◽  
Its Region ◽  
Nematode Species ◽  
Original Description ◽  
Root Surface ◽  
Mature Female ◽  
Root Knot Nematode ◽  
Population Densities ◽  
Root Knot Nematodes ◽  
First Report

Bananas (Musa spp.) are one of world's most popular fruits, and China is the third largest banana-producing country in the world. Root-knot nematodes, Meloidogyne spp., are common pests of banana worldwide, but damage to this crop caused by M. graminicola has not been reported up to now. During a survey of root-knot nematode species infecting banana in Fujian Province, China, swollen, galled primary and secondary root samples of Musa nana cv. Tianbao (AAA) were collected from two commercial fields in Nanjing County in May 2013. The affected plants did not exhibit obvious above-ground symptoms. Seriously infected roots were malformed and dehiscent, with the tissue discolored and rotting. Examination of symptomatic roots revealed one to several females of Meloidogyne sp. within each gall, with egg masses that were often completely embedded within the gall without protruding through the root surface, and with second-stage juveniles (J2) hatched inside the galls. Population densities of this nematode ranged from 452 to 2,056 eggs and J2 per 5 g of fresh roots. Males were rarely observed. Morphological measurements of 25 females and 20 J2 matched the original description of M. graminicola (1). The perineal patterns of females were dorsoventrally ovoid, with low to moderately high and round dorsal arches and lacking obvious lateral lines; striae were smooth and some were broken by a few obvious irregular, zig-zag striae in the dorsal part of the pattern; phasmids were close together (13.1 to 19.7 μm). The J2 had long tapered tails (63.4 to 75.5 μm), with long narrow hyalines (13.1 to 19.9 μm) and marked clavate termini. DNA was extracted from one mature female. The ITS1-5.8S-ITS2 rDNA region was amplified with V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (2) and the COII and IRNA mtDNA genes were amplified with C2F3/MRH106 (GGTCAATG TTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTAGT) (3) and then sequenced. The sequences were subjected to a database search using BLAST to verify the identity. Sequences from the ITS region were 788 bp (GenBank Accession Nos. KM111531 and KM236560) and were 96.8 to 99.1% identical to the known sequences of M. graminicola in Genbank. Sequences from the mtDNA were 666 bp (KM111533 and KM236559) and showed 99.1 to 99.4% homology with the known sequences of M. graminicola (KJ139963 and HG529223). In glasshouse tests, banana plantlets (M. nana cv. Tianbao) about 20 cm high were transplanted in 25-cm-diameter pots and inoculated with 5,000 J2 of each collected population of M. graminicola replicated six times; a noninoculated control was included. After 15 weeks, all inoculated plants were stunted and chlorotic. Galling symptoms on roots were similar to those in the field, and dissection of galled root tissue revealed that different life stages of the nematode were present, with population densities ranging from 1,238 to 6,562 eggs and J2 per 5 g of fresh roots. The noninoculated control plants grew well and had no galling symptoms on the roots. These results confirmed the nematodes' pathogenicity on banana. On the basis of these results, the root-knot nematodes isolated from banana in Nanjing County were confirmed as M. graminicola. To our knowledge, this is the first report of a natural infection of banana with M. graminicola. References: (1) A.M. Golden and W. Birchfield. Plant Dis. Rep. 52:423, 1968. (2) T. C. Vrain et al. Fund. Appl. Nematol. 15:565, 1992. (3) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004.

scholarly journals Management of root-knot nematode Meloidogyne incognita of eggplant using some growth-promoting rhizobacteria and chitosan under greenhouse conditions

2020 ◽  
Vol 30 (1) ◽  
Author(s):  
Usama Samy Elkelany ◽  
Nehal Samy El-Mougy ◽  
Mokhtar Mohamed Abdel-Kader
Keyword(s):  
Bacillus Subtilis ◽  
Plant Growth ◽  
Meloidogyne Incognita ◽  
Growth Parameters ◽  
Azotobacter Chroococcum ◽  
Economic Losses ◽  
Egg Mass ◽  
Root Knot Nematode ◽  
Wide Range ◽  
Growth Promoting

Abstract Background Eggplant (Solanum melongena) is one of the most popular vegetable crops in Egypt. It is affected by a wide range of pests; prominent among them is root-knot nematode (RKN) Meloidogyne spp. which constitutes a major group of plant-parasitic nematodes causing great economic losses worldwide especially in Egypt. Main body The present investigation was performed under greenhouse conditions to evaluate the potentials of 3 growth-promoting bacteria, Azospirilum brasilense, Azotobacter chroococcum, and Bacillus subtilis, as well as chitosan for the control of the nematode Meloidogyne incognita causes root-knot disease of eggplant cv. Baladi. All treatments reduced (p ≤ 0.05) the nematode population in soil and roots as well as enhanced the plant growth parameters of eggplant remarkably than the control. The applied treatments varied in their efficacy against the plant nematode infection in correspondence to the time of application. The recorded results demonstrated that maximum reduction in J2 in soil, egg mass/root, and eggs/egg masses were obtained by treating the soil with Bacillus subtilis followed by Azospirilum brasilense and Azotobacter chroococcum. Also, chitosan resulted in high reduction in root galls compared to control treatment. Conclusion The use of plant growth-promoting rhizobacteria, Azospirilum brasilense, Azotobacter chroococcum, Bacillus subtilis, and chitosan achieved efficient control to Meloidogyne incognita and consequently increase eggplant growth parameters under greenhouse conditions. The present results suggested introducing such rhizobacteria in integrated nematode management program.

scholarly journals Variations in the level of resistance to root-knot nematodes (Meloidogyne spp.) infestation among ten cowpeas (Vigna unguiculata L. Walp.) genotypes

2019 ◽  
Vol 54 (2) ◽  
pp. 68-78
Author(s):  
F. Kankam ◽  
E. N.K. Sowley ◽  
J. Adomako ◽  
A. Boateng
Keyword(s):  
Vigna Unguiculata ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
Second Stage ◽  
Randomized Design ◽  
Significant Difference ◽  
Environmentally Safe ◽  
Meloidogyne Spp ◽  
The University ◽  
Moderately Resistant

The cultivation of cowpea (Vigna unguiculata L. Walp.) cultivars that are tolerant to root-knot nematode attack is among the environmentally safe approach to managing the root-knot nematode menace in cultivated crops. In this study, the tolerance of 10 cowpea genotypes to root-knot nematodes infestation was evaluated in a pot experiment conducted in a Screenhouse, at the University for Development Studies, Nyankpala Campus. The experiment was laid out in a completely randomized design with three replications. The number of second stage juveniles (J2) per 250 cm3 of soil sample were counted while the severity of root-knot nematode damage (root galls) was assessed. The reproduction index (RI) was used to classify the varieties as resistant or susceptible. There was a significant difference (P < 0.05) in the number of second stage juveniles of root-knot nematode (RKN), galling index and RI among the genotypes tested. The study revealed that cowpea genotypes SARI 1-4-90, Padi tuya, Songotra, IT99K-1122, Sanzi and Apagbaala were moderately resistant whereas cowpea genotypes IT86D-610, Zaayura, SARI 5-5-5 and IT07K-299-6 were slightly resistant. Thus, the six moderately resistant cowpea genotypes were suggested to be used as a source of resistance to RKN in future breeding works.

Sign in / Sign up

Export Citation Format

Share Document