scholarly journals Effect of family disintegration on age at menarche

2015 ◽  
Vol 44 (2) ◽  
pp. 124
Author(s):  
Alma Toromanović ◽  
Husref Tahirović ◽  
Collaborators from pediatric Centers in Bosnia and Herzegovina
Keyword(s):  
Confidence Interval ◽  
Single Mother ◽  
Probit Analysis ◽  
Normal Families ◽  
Age At Menarche ◽  
Dysfunctional Families ◽  
Sibship Size ◽  
Cross Sectional ◽  
Intact Families ◽  
The Impact

<p><strong>Objective</strong>. The aim of this study was to determine the effect of psychosocial factors on the age at menarche of girls in Federation of Bosnia and Herzegovina (FBH). <strong>Subjects and methods</strong>. A cross-sectional study was conducted from September 2002 to May 2003 in all Cantons of the FBH. The random stratified sample included 19.803 girls aged 9.0 to 17.5 years. Data were collected using the status quo method. Probit analysis was used to estimate median age at menarche and 95% confidence intervals. <strong>Results</strong>. The present study shows that menarche occurred significantly earlier (p&lt;0.05) in girls from dysfunctional families (median: 12.99 years, 95% confidence interval: 12.93-13.05) than in girls who grew up in intact families (median: 13.04 years, 95% confidence interval: 13.01-13.07). Analyzing separately the impact of each of family stressors on age at menarche, we found that menarcheal age was significantly lower in girls from single-mother families, whose parents are divorced, whose one parent is died and where alcoholism in family is present than in girls from intact families. Maturation was found to be earlier in girls from dysfunctional families then in those from intact families after the influence of place of residence and sibship size was eliminated. <strong>Conclusion</strong>. From our research we can conclude that the girls from dysfunctional families reached earlier age at menarche than their peers who grew up in normal families, and that this effect did not disappear after controlling for socioeconomic<br />variables.</p>

scholarly journals Menarcheal age of girls from dysfunctional families

2004 ◽  
Vol 4 (3) ◽  
pp. 5-6 ◽  
Author(s):  
Alma Toromanović ◽  
Husref Tahirović
Keyword(s):  
Life Events ◽  
Probit Analysis ◽  
Normal Families ◽  
Age At Menarche ◽  
Dysfunctional Families ◽  
Menarcheal Age ◽  
Group A ◽  
The Mean ◽  
Group B ◽  
Clear Shift

The objective of the present study was to determine median age at menarche and the influence of familial instability on maturation. The sample included 7047 girls between the ages of 9 and 17 years from Tuzla Canton. The girls were divided into two groups. Group A (N=5230) comprised girls who lived in families free of strong traumatic events. Group B (N=1817) included girls whose family dysfunction exposed them to prolonged distress. Probit analysis was performed to estimate mean menarcheal age using the Probit procedure of SAS package. The mean menarcheal age calculated by probit analysis for all the girls studied was 13.07 years. In girls from dysfunctional families a very clear shift toward earlier maturation was observed. The mean age at menarche for group B was 13.0 years, which was significantly lower that that for group A, 13.11 years (t=2.92, P<0.01). The results surveyed here lead to the conclusion that girls from dysfunctional families mature not later but even earlier than girls from normal families. This supports the hypothesis that stressful childhood life events accelerate maturation of girls.

Age at menarche and the menstrual pattern of secondary school adolescents in central India

2017 ◽  
Vol 5 (8) ◽  
pp. 3610
Author(s):  
Rakhee Ambade ◽  
Mohan Sagdeo
Keyword(s):  
Central India ◽  
Cross Sectional Study ◽  
Probit Analysis ◽  
Age At Menarche ◽  
Cross Sectional ◽  
Menstrual Cycles ◽  
Background Population ◽  
The Status ◽  
School Girls ◽  
Age Of Menarche

Background: Population studies on characteristics of menstrual cycles are scarce. Knowledge on this variability is necessary for patient education and to guide clinical evaluation.Methods: A cross sectional study was conducted and 622 school girls were selected randomly. A pretested questionnaire was used to gather data.Results: Mean age of participants was 16.9 ± 1 years. About 92.2% had attained menarche. Probit analysis of the status-quo data yielded median age at menarche of 14.8 (13.9-15.3) years and by recall method to be 15.8 ± 1 years. The mean age at menarche was, significantly, 0.3 years younger for urban females compared with rural ones. Cycle length between 21-35 days was observed in 70.3% of the girls. Mean duration of flow was 4 ± 1.3 days. Menstrual cycles were irregular in 42.8% of the subjects. Overall prevalence of dysmenorrhoea was 72%. and of PMS was 75.4%.Conclusions: Age of menarche was found to be significantly delayed. Considerable number of students complained of dysmenorrhoea and premenstrual symptoms.

scholarly journals Does insomnia modify the association between C-reactive protein and migraine? The Tromsø Study 2015–2016

Cephalalgia ◽  
2019 ◽  
Vol 39 (8) ◽  
pp. 1022-1029 ◽  
Author(s):  
Knut Hagen ◽  
Laila A Hopstock ◽  
Anne Elise Eggen ◽  
Ellisiv B Mathiesen ◽  
Kristian Bernhard Nilsen
Keyword(s):  
Confidence Interval ◽  
Migraine With Aura ◽  
Odds Ratio ◽  
Migraine Without Aura ◽  
High Sensitivity ◽  
C Reactive Protein ◽  
Cross Sectional ◽  
Reactive Protein ◽  
The Impact ◽  
Migrainous Headache

Background The relationship between high sensitivity C-reactive protein and migraine is unclear. The aim of this cross-sectional population-based study was to investigate the association between high sensitivity C-reactive protein and types of headache, and to evaluate the impact of insomnia on this association. Methods A total of 20,486 (63%) out of 32,591 invited, aged ≥40 years or older, participated in the seventh wave of the Tromsø study conducted in 2015–2016 and had valid information on headache, insomnia and high sensitivity C-reactive protein. The influence of insomnia on the association between questionnaire-based diagnoses of headache and elevated high sensitivity C-reactive protein defined as >3.0 mg/L was assessed using multiple logistic regression, estimating prevalence odds ratio with 95% confidence intervals. Results A total of 6290 participants (30.7%) suffered from headache during the last year. Among these, 1736 (8.5%) fulfilled the criteria of migraine, 991 (4.8%) had migraine with aura, 746 (3.6%) migraine without aura (3.8%), and 4554 (22.2%) had non-migrainous headache. In the final multi-adjusted analysis, elevated high sensitivity C-reactive protein was associated with headache (odds ratio 1.10, 95% confidence interval 1.01–1.20), migraine (odds ratio 1.17, 95% confidence interval 1.01–1.35), and migraine with aura (odds ratio 1.23, 95% confidence interval 1.01–1.53). No association was found between elevated high sensitivity C-reactive protein and migraine without aura or non-migrainous headache. The association between high sensitivity C-reactive protein and migraine was strongly dependent on insomnia status. Among individuals with insomnia, elevated high sensitivity C-reactive protein was associated with migraine (odds ratio 1.49, 95% confidence interval 1.02–2.17), and migraine with aura (odds ratio 1.59, 95% confidence interval 1.03–2.45), whereas no such relationship was found among those without insomnia. Conclusions In this cross-sectional study, participants with migraine, in particular migraine with aura, were more likely to have elevated high sensitivity C-reactive protein, evident only among those with insomnia.

scholarly journals Back Pain Beliefs Are Related to the Impact of Low Back Pain in 17-Year-Olds

2012 ◽  
Vol 92 (10) ◽  
pp. 1258-1267 ◽  
Author(s):  
Anne J. Smith ◽  
Peter B. O'Sullivan ◽  
Darren Beales ◽  
Leon Straker
Keyword(s):  
Low Back Pain ◽  
Back Pain ◽  
Confidence Interval ◽  
Short Form ◽  
Well Being ◽  
Late Adolescence ◽  
Low Back ◽  
Cross Sectional ◽  
Pain Beliefs ◽  
The Impact

Background Disability in adults with low back pain (LBP) is associated with negative back pain beliefs (BPBs). Adult BPBs can be positively influenced with education, resulting in reduced LBP disability. By late adolescence, the prevalence of LBP reaches adult levels. The relationship among LBP experience, LBP impact, and BPBs has not been investigated in late adolescence. Objective The aim of this study was to document unknown relationships among LBP experience, LBP impact, and BPBs in 17-year-olds. Design A cross-sectional study design was used. Methods Adolescents (n=1,126) in the Raine Study provided full information on LBP, LBP impact (sought professional advice or treatment, taken medication, missed school or work, interfered with normal activities, interfered with physical activities), BPBs, and a number of covariates. Results Back pain beliefs were more positive in participants with experience of LBP (X̄=30.2, SD=5.6) than in those without experience of LBP (X̄=28.5, SD=5.1). Individuals with LBP without activity modification impacts had more positive BPBs than those with activity modification impacts, even after adjustment for mental well-being and sex. The adjusted difference in BPBs between participants with experience of LBP but no activity modification impacts and those reporting all 3 activity modification impacts was 2.9 points (95% confidence interval=1.7 to 4.2). Participants with no activity modification impacts had more positive BPBs than those with no experience of LBP (adjusted difference=2.2 points, 95% confidence interval=1.4 to 2.9). More positive BPBs also were associated with female sex, lower body mass index, higher family income, better 36-Item Short-Form Health Survey (SF-36) Mental Health scale scores, and more positive primary caregiver beliefs. Limitations Cause and effect cannot be ascertained with the cross-sectional design. Conclusion Differences in BPBs are associated with different levels of LBP impact at 17 years of age. This finding provides a potential target for intervention early during the life course.

scholarly journals Recombinant Human Thyrotropin-Stimulated Radioiodine Therapy of Large Nodular Goiters Facilitates Tracheal Decompression and Improves Inspiration

2008 ◽  
Vol 93 (10) ◽  
pp. 3981-3984 ◽  
Author(s):  
Steen J. Bonnema ◽  
Viveque E. Nielsen ◽  
Henrik Boel-Jørgensen ◽  
Peter Grupe ◽  
Peter B. Andersen ◽  
...  
Keyword(s):  
Confidence Interval ◽  
Pulmonary Function ◽  
Vital Capacity ◽  
131I Therapy ◽  
Individual Change ◽  
Cross Sectional ◽  
Group A ◽  
Recombinant Human Thyrotropin ◽  
Double Blinded ◽  
The Impact

Introduction: The impact on tracheal anatomy and respiratory function of recombinant human (rh)TSH-stimulated 131I therapy in patients with goiter is not clarified. Methods: In a double-blinded design, patients (age 37–87 yr) with a large multinodular goiter (range, 99–440 ml) were randomized to placebo (n = 15) or 0.3 mg rhTSH (n = 14) 24 h before 131I therapy. The smallest cross-sectional area of the trachea (SCAT; assessed by magnetic resonance imaging) and the pulmonary function were determined before, 1 wk, and 12 months after therapy. Results: Data on goiter reduction have been reported previously. In the placebo group, no significant changes in the lung function or SCAT were found throughout the study. In the rhTSH group, a slight decrease was observed in the forced vital capacity 1 wk after therapy, whereas the mean individual change in SCAT was significantly increased by 10.5% (95% confidence interval = 0.9–20.0%). A further increase in SCAT to 117 ± 36 mm2 (P = 0.005 compared with 92 ± 38 mm2 at baseline) was seen at 12 months, corresponding to a mean of 31.4% (95% confidence interval = 16.0–46.8%). The expiratory parameters did not change significantly, whereas forced inspiratory flow at 50% of the vital capacity (FIF50%) increased from initially 3.34 ± 1.33 liters/sec to ultimately 4.23 ± 1.88 liters/sec (P = 0.015) in the rhTSH group, corresponding to a median increase of 24.6%. By 12 months, the relative improvements in FIF50% and in SCAT were inversely correlated to the respective baseline values (FIF50%: r = −0.47, P = 0.012; SCAT: r = −0.57, P = 0.001). Conclusion: On average, neither compression of the trachea nor deterioration of the pulmonary function was observed in the acute phase after rhTSH-augmented 131I therapy. In the long term, tracheal compression is diminished, and the inspiratory capacity improved, compared with 131I therapy alone.

scholarly journals Ethnic disparities in COVID-19 mortality in Mexico: a cross-sectional study based on national data

2020 ◽  
Author(s):  
Ismael Ibarra-Nava ◽  
Kathia G. Flores-Rodriguez ◽  
Violeta Ruiz-Herrera ◽  
Hilda C. Ochoa-Bayona ◽  
Alfonso Salinas-Zertuche ◽  
...  
Keyword(s):  
Confidence Interval ◽  
Indigenous People ◽  
Indigenous Peoples ◽  
Odds Ratio ◽  
Adjusted Odds Ratio ◽  
Cross Sectional Study ◽  
Sectional Study ◽  
Cross Sectional ◽  
Large Sample ◽  
The Impact

Objectives: To analyze the mortality associated with ethnicity, particularly of Indigenous peoples, in a large sample of patients with COVID-19 in Mexico. Design: National, cross-sectional study. Setting: Mexico. Participants: 416546 adult patients; 4178 Indigenous peoples with COVID-19 were the primary population under study. Main outcome measures: The primary outcome was mortality from COVID-19 up to August 3rd, 2020. Logistic regression was used to calculate odds ratios while adjusting for confounders. Results: Among all patients with COVID-19, whether hospitalized or not, a higher proportion of Indigenous peoples died compared to non-Indigenous people (16.5% vs 11.1%, respectively). Among hospitalized patients, a higher proportion of Indigenous peoples died (37.1%) compared to non-Indigenous peoples (36.3%). Deaths outside the hospital were also higher among Indigenous peoples (3.7% vs 1.7%). A higher proportion of Indigenous peoples died in both the private and public health care sectors. The adjusted odds ratio for COVID-19 mortality among Indigenous peoples with COVID-19 was 1.13 (95% confidence interval 1.03 to 1.24). The adjusted odds ratio for COVID-19 mortality among Indigenous peoples with COVID-19 was higher among those who received only ambulatory care (1.55, 95% confidence interval 1.24 to 1.92). Conclusions: In the large sample of patients with COVID-19, the findings suggest that Indigenous peoples in Mexico have a higher risk of death from COVID-19, especially outside the hospital. These findings suggest Indigenous peoples lack access to care more so than non-Indigenous people during the COVID-19 pandemic in Mexico. More research is needed regarding the impact of the COVID-19 among racial and ethnic minorities in Mexico.

scholarly journals Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

2018 ◽  
Vol 46 (1) ◽  
pp. 7
Author(s):  
Ruy Brayner de Oliveira Filho ◽  
Karla Campos Malta ◽  
Érica Chaves Lúcio ◽  
Glaucia Grazielle Nascimento ◽  
Lucas Da Costa Dutra ◽  
...  
Keyword(s):  
Confidence Interval ◽  
Dairy Cows ◽  
Statistical Error ◽  
Federal District ◽  
Laboratory Diagnosis ◽  
Direct Immunofluorescence ◽  
Cross Sectional ◽  
Campylobacter Fetus ◽  
Fetus Subsp ◽  
The Impact

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction  was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.

Multidisciplinary team decision is rare and decreasing in percutaneous vascular interventions despite positive impact on in-hospital outcomes

VASA ◽  
2019 ◽  
Vol 48 (3) ◽  
pp. 262-269 ◽  
Author(s):  
Christian-Alexander Behrendt ◽  
Tilo Kölbel ◽  
Thea Schwaneberg ◽  
Holger Diener ◽  
Ralf Hohnhold ◽  
...  
Keyword(s):  
Multidisciplinary Team ◽  
Positive Impact ◽  
Cross Sectional Study ◽  
Invasive Treatment ◽  
Cross Sectional ◽  
Hospital Outcomes ◽  
Vascular Intervention ◽  
Medical Specialties ◽  
Team Decision ◽  
The Impact

Abstract. Background: Worldwide prevalence of peripheral artery disease (PAD) is increasing and peripheral vascular intervention (PVI) has become the primary invasive treatment. There is evidence that multidisciplinary team decision-making (MTD) has an impact on in-hospital outcomes. This study aims to depict practice patterns and time changes regarding MTD of different medical specialties. Methods: This is a retrospective cross-sectional study design. 20,748 invasive, percutaneous PVI of PAD conducted in the metropolitan area of Hamburg (Germany) were consecutively collected between January 2004 and December 2014. Results: MTD prior to PVI was associated with lower odds of early unsuccessful termination of the procedures (Odds Ratio 0.662, p < 0.001). The proportion of MTD decreased over the study period (30.9 % until 2009 vs. 16.6 % from 2010, p < 0.001) while rates of critical limb-threatening ischemia (34.5 % vs. 42.1 %), patients´ age (70 vs. 72 years), PVI below-the-knee (BTK) (13.2 % vs. 22.4 %), and rates of severe TASC C/D lesions BTK (43.2 % vs. 54.2 %) increased (all p < 0.001). Utilization of MTD was different between medical specialties with lowest frequency in procedures performed by internists when compared to other medical specialties (7.1 % vs. 25.7 %, p < 0.001). Conclusions: MTD prior to PVI is associated with technical success of the procedure. Nonetheless, rates of MTD prior to PVI are decreasing during the study period. Future studies should address the impact of multidisciplinary vascular teams on long-term outcomes.

Association between reproductive factors and postmenopausal osteoporosis

2011 ◽  
Vol 20 (03) ◽  
pp. 248-251
Author(s):  
H. R. Meybodi ◽  
N. Khalili ◽  
P. Khashayar ◽  
R. Heshmat ◽  
A. Hossein-nezhad ◽  
...  
Keyword(s):  
Bone Mineral Density ◽  
Bone Mineral ◽  
Reproductive Factors ◽  
Population Based ◽  
Age At Menarche ◽  
Mineral Density ◽  
Cross Sectional ◽  
Number Of Children ◽  
Menstrual History ◽  
Duration Of Breastfeeding

SummaryThe present cross-sectional research was designed to study possible correlations between clinical reproductive factors and bone mineral density (BMD) values.Using the data gathered by the population-based Iranian Multicenter Osteoporosis Study (IMOS), we investigated the correlation found between reproductive factors and osteoporosis. Subjects were recruited from five major cities of Iran. Bone mineral density was measured using Dual-Energy X-ray Absorptiometry and the results were analyzed against the age at menarche and at menopause, number of pregnancies, children and abortions, and the history (and duration) of breastfeeding.Data was available for 2528 women. Gravidity and number of children were reversely correlated with BMD. Younger age at menarche was associated with higher BMD values, whereas there was no significant correlation between age at menopause and menstrual history and BMD.Our study suggests that clinical reproductive factors, particularly number of children and breastfeeding, could be incorporated as predictors of BMD levels in women. Given the controversial results obtained in different studies, longitudinal studies should be carried out to enlighten the importance of these factors and the rationale of their use to predict BMD values in different settings.

HUBUNGAN KARAKTERISTIK PASIEN DENGAN PEMAHAMAN PERSETUJUAN TINDAKAN MEDIS PADA TINDAKAN BEDAH DI RUMAH SAKITPERTAMINA BINTANG AMIN (RSPBA) BANDAR LAMPUNG BULAN MARET 2015

2019 ◽  
Vol 6 (1) ◽  
pp. 19-28
Author(s):  
Rakhmie Rafie ◽  
Yusmaidi Yusmaidi ◽  
Mira Fitriyani
Keyword(s):  
Informed Consent ◽  
Confidence Interval ◽  
P Value ◽  
Chi Square ◽  
Cross Sectional

Berdasarkan Permenkes 585/1989 dikatakan bahwa informed consent adalah persetujuan yang diberikan oleh pasien atau keluarganya atas dasar penjelasan mengenai tindakan medis yang akan dilakukan terhadap pasien tersebut. Peran dan tanggung jawab dokter terhadap pelaksanaan tindakan medis berdasarkan imformed consent sangat penting untuk mencegah kemungkinan yang akan terjadi kepada pasien nantinya. Pemahaman terhadap informasi yang diberikan dipengaruhi oleh beberapa faktor, diantaranya karakteristik orang tersebut. Survey analitik dengan desain cross sectional dengan wawancara terpimpin menggunakan kuesioner terhadap 100 responden, dan diolah menggunakan analisa univariat dan bivariat dengan uji Chi-Square. Hasil penelitian menunjukkan bahwa: yang berusia dewasa 84 responden (84%) dan yang berusia muda sebanyak 16 responden (16%), laki- laki 63 responden (63%) dan perempuan 37 responden (37%), yang berpendidikan rendah 41 responden (41%) dan yang berpendidikan tinggi 59 responden, yang tidak bekerja 24 responden (24%) sedangkan yang bekerja 76 responden (76%), yang mempunyai pemahaman baik 58 responden (58%) dan yang tidak baik sebanyak 42 responden (42%). Variabel yang terdapat hubungan bermakna dengan pemahaman terhadap persetujuan tindakan medis pada tindakan bedah di RSPBA pada bulan Maret 2015 adalah umur (nilai p value = 0,037) OR = 3.761 dengan nilai Confidence Interval (1.195-11.835)dan pendidikan (nilai p value = 0,00) OR = 8.551 dengan Confidence Interval (3.436-21.285). Sedangkan variabel yang tidak terdapat hubungan bermakna dengan pemahaman persetujuan tindakan medispada tindakan bedah di RSPBA pada bulan Maret 2015 adalah jenis kelamin (nilai p value = 0,987) dan pekerjaan (p value = 0,251). Terdapat hubungan bermakna antara umur dan pendidikan dengan pemahaman terhadap persetujuan tindakan medis pada tindakan bedah di RS Pertamina Bintang Aamin (RSPBA) pada bulan Maret 2015.  

Sign in / Sign up

Export Citation Format

Share Document