Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees

2012 ◽  
Vol 58 (12) ◽  
pp. 1344-1352 ◽  
Author(s):  
Renáta Vadkertiová ◽  
Jana Molnárová ◽  
Dana Vránová ◽  
Elena Sláviková
Keyword(s):  
Aureobasidium Pullulans ◽  
Fruit Trees ◽  
Individual Species ◽  
Pichia Kudriavzevii ◽  
Hanseniaspora Uvarum ◽  
Yeast Community ◽  
Fruit Samples ◽  
Pear Trees ◽  
Pichia Kluyveri ◽  
Isolated Species

Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.

Biodiversity of epiphytic and endophytic yeasts on grape berries in Iran

Nova Hedwigia ◽  
2020 ◽  
Vol 110 (1) ◽  
pp. 137-156
Author(s):  
Bahareh Ghanbarzadeh ◽  
Asadollah Babaie Ahari ◽  
Jose Paulo Sampaio ◽  
Mahdi Arzanlou
Keyword(s):  
Species Diversity ◽  
Aureobasidium Pullulans ◽  
Yeast Species ◽  
First Report ◽  
Grape Berries ◽  
Predominant Species ◽  
Hanseniaspora Uvarum ◽  
Yeast Community ◽  
Evenness Index ◽  
Isolated Species

Although Iran represents one of the presumed centers of domestication of grapevines, there is a huge paucity of knowledge on yeast species diversity on grapevines in Iran. This study was performed to explore the species diversity amongst the epiphytic and endophytic yeast community on grape berries in Iran. Five different regions were selected for sampling. Out of 59 collected samples, 352 yeast isolates were recovered, of those 315 isolates were epiphytes and 37 isolates were endophytes. Species were identified by a combination of M13 fingerprinting and sequencing the D1/D2 region of 26SrDNA. Twenty three different species were identified as epiphytes and 74% of them were Ascomycota. Among these species, seven (all ascomycetous) were also isolated as endophytes. Hanseniaspora uvarum was the predominant species both in epiphyte and endophyte detection and had the highest biodiversity (H') and evenness index (E). Other species such as Pichia terricola, Metschnikowia sinensis and Aureobasidium pullulans were the further most frequently isolated species. This is the first report of Candida membranifaciens as inhabitants of grape berries.

scholarly journals Lichens of fruit trees in the selected locations in Podlaskie Voivodeship [North-Eastern Poland]

2017 ◽  
Vol 28 (4) ◽  
pp. 5-9 ◽  
Author(s):  
Anna Matwiejuk
Keyword(s):  
Fruit Trees ◽  
Lichen Species ◽  
Apple Trees ◽  
Partial Protection ◽  
Lichen Biota ◽  
North Eastern ◽  
Pear Trees ◽  
Fruit Orchards ◽  
Ramalina Farinacea

Abstract The aim of this paper is to present the diversity of the lichen species on fruit trees (Malus sp., Pyrus sp., Prunus sp. and Cerasus sp.) growing in orchards in selected villages and towns in the Podlaskie Voivodeship. Fifty-six species of lichens were found. These were dominated by common lichens found on the bark of trees growing in built-up areas with prevailing heliophilous and nitrophilous species of the genera Physcia and Phaeophyscia. A richer lichen biota is characteristic of apple trees (52 species) and pear trees (36). Lichens of the apple trees constitute 78% of the biota of this phorophyte growing in the fruit orchards in Poland. Of the recorded species, only two (Ramalina farinacea, Usnea hirta) are covered by partial protection in Poland.

scholarly journals Free amino acids in the xylem sap of pear trees during dormancy

2016 ◽  
Vol 46 (7) ◽  
pp. 1136-1141 ◽  
Author(s):  
Anderson Carlos Marafon ◽  
Flavio Gilberto Herter ◽  
Fernando José Hawerroth ◽  
Adriana Neutzling Bierhals
Keyword(s):  
Amino Acids ◽  
Water Content ◽  
Free Amino Acids ◽  
Free Amino ◽  
Storage Proteins ◽  
Xylem Sap ◽  
Fruit Trees ◽  
Temperate Climate ◽  
Pear Trees ◽  
Effective Use

ABSTRACT: Storage and remobilization are considered key processes for the effective use of nitrogen in temperate fruit trees. As dormancy begins, storage proteins are synthesized, coinciding with a reduction in the levels of free amino acids. Consequently, as dormancy breaks, these storage proteins are degraded, and an increase in the concentrations of amino acids occurs, in order to support new growth. The objective of this study was to evaluate water content of different vegetative tissues (buds, bark, and bole wood), volume of xylem sap, and free amino acid concentrations of xylem sap, during winter dormancy of Hosui Japanese pear trees (VL). Plant material was obtained from the Embrapa Temperate Climate experimental orchard at Pelotas, in the state of Rio Grande do Sul, Brazil. Xylem sap was extracted from the branches with the aid of a vacuum pump, and the free amino acids were determined by gas chromatography, using the EZ kit: Faast GC/FID (Phenomenex). Water content of buds, as well as the volume of sap and concentrations of both aspartic acid and asparagine, substantially increased over time, reaching maximum values in the phase preceding sprouting.

scholarly journals Nectar production of pear (Pyrus communis L.) cultivars

2000 ◽  
Vol 6 (3) ◽  
Author(s):  
P. Benedek ◽  
G. Kocsisné Molnár ◽  
J. Nyéki
Keyword(s):  
World Literature ◽  
Fruit Trees ◽  
Significant Negative Correlation ◽  
Sugar Concentration ◽  
Cold Weather ◽  
Nectar Production ◽  
Pyrus Communis L ◽  
The World ◽  
Pear Trees ◽  
Very High

Detailed studies were made on the nectar production of 44, 16 and 18 pear cultivars, respectively, in a cultivar collection of pear during three consecutive years with highly different weather in the blooming. Results clearly show that pear does not necessarily produce small amount of nectar as stated in the world literature. In fact, pear can produce extremely high amount of nectar sometimes much higher than other temperate zone fruit trees species but its nectar production is highly subjected to weather, first of all to air temperature. Low nectar production seems to be more frequent than high one and cold weather can prevent its nectar production at all. On the other hand, results corroborate to the earlier statements on the low sugar concentration of pear nectar. There is a highly significant negative correlation between the amount of nectar produced by pear flowers and its sugar concentration (r = -0.52, n = 291, p< 0.001 for 1996, r = -0.34, n = 197, p< 0.001 for 1998). Sugar concentration in individual flowers may be up, to 40% in exceptional cases but generally it is well below 20%. Very high figures for sugar concentration in pear nectar at the literature seem to be incomprehensible. In contrast of some earlier statement in the literature no real difference could be established in the nectar production of pear cultivars, based on much more measurements than in earlier studies. Very low sugar concentration in pear nectar can explain the fact that the overwhelming majority of honeybees are pollen gatherers at pear trees even in the case of exceptionally high nectar production.  

scholarly journals Dynamic behavior of Saccharomyces cerevisiae, Pichia kluyveri and Hanseniaspora uvarum during spontaneous and inoculated cocoa fermentations and their effect on sensory characteristics of chocolate

LWT ◽  
2015 ◽  
Vol 63 (1) ◽  
pp. 221-227 ◽  
Author(s):  
Nadia Nara Batista ◽  
Cíntia Lacerda Ramos ◽  
Disney Dias Ribeiro ◽  
Ana Carla Marques Pinheiro ◽  
Rosane Freitas Schwan
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Dynamic Behavior ◽  
Sensory Characteristics ◽  
Hanseniaspora Uvarum ◽  
Pichia Kluyveri

Larvae of the North American Olethreutidae (Lepidoptera)

1959 ◽  
Vol 91 (S10) ◽  
pp. 5-338 ◽  
Author(s):  
Margaret Rae MacKay
Keyword(s):  
North American ◽  
Fruit Trees ◽  
Individual Species ◽  
The North ◽  
The Family ◽  
Late Instar ◽  
Species Groups ◽  
Relationship Of ◽  
Spruce Needles ◽  
The Relationship

AbstractThe late-instar larvae of about 185 species of the North American Olethreutidae are described and most of them illustrated. Included in these are many pests, such as Grapholitha molesta, Carpocapsa pomonella, and Spilonota ocellana on fruit trees, Paralobesia viteana on grapes, Ancylis comptana fragariae on strawberries, Laspeyresia nigricana in pea pods, Laspeyresia caryana in hickory and pecan nuts, Taniva albolineana in spruce needles, and species of Rhyacionia and Petrova on pines. Keys to species groups and to individual species are provided. Of the diagnostic and specialized characters listed, the most useful include the setae, the spinneret, and the shape of the larva, especially of its head and anal shield. The main characters are given for the postulated ancestral larva and for the highly developed larva. Most of the species groups are arranged according to the suggested phylogenetic relationship of their larvae, emphasizing the necessity of a revision of the family. Larvae of some genera previously difficult to classify, such as Pseudogalleria and Hystricophora, indicate the relationship of those genera to other groups; conversely, lack of relationship is clearly shown in other instances, e.g., between Carpocapsa pomonella and Carpocapsa saltitans, and between the two species Epiblema culminana and E. suffusana and other members of the genus Epiblema.

scholarly journals Effect of the application of prohexadione-calcium on the growth of ‘Packham’s Triumph’ and ‘Hosui’ pears (Pyrus communis L.)

2021 ◽  
Vol 10 (8) ◽  
pp. e3110816801
Author(s):  
Odair Ângelo Dalzochio ◽  
Wendel Paulo Silvestre ◽  
Gabriel Fernandes Pauletti
Keyword(s):  
Growth Regulator ◽  
Vegetative Growth ◽  
Fruit Trees ◽  
Fruit Production ◽  
Quality Parameters ◽  
Agricultural Practice ◽  
Pyrus Communis L ◽  
Pear Trees ◽  
Prohexadione Calcium ◽  
Different Doses

The necessity of controlling the vegetative growth of fruit trees is a growing concern for farmers since vigorous plants tend to have lower fruit yields. The use of chemicals that inhibit the vegetative growth of plants, such as prohexadione-calcium (PCa), an inhibitor of gibberellins which is currently used as a growth regulator for apple trees, is an agricultural practice aimed to help in reducing pruning time and cost. Pear trees grafted on vigorous rootstocks tend to present high rates of vegetative growth, hindering fruit production. Thus, this work aimed to evaluate the effect of the application of different doses of the plant growth regulator PCa on the vegetative growth, pruning time, radiation incidence, and productive and quality parameters of ‘Packham’s Triumph’ and ‘Hosui’ pears grafted on vigorous rootstocks. Two PCa applications were carried out, the first after the falling of petals (2009-10-10), and the second twenty-one days after the first (2009-11-02). The observed results showed a significant effect of PCa in reducing the vegetative growth of the pear trees and the pruning time in both cultivars. The effect on photosynthetic active radiation (PAR) was observed only in the ‘Packham’s Triumph’ variety, not being observed for the ‘Hosui’ pear trees. No statistical difference was observed relative to the quality parameters and yield of the fruits, in both cultivars, showing that PCa application has not caused any deleterious effect on fruit development.

scholarly journals First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia

Plant Disease ◽  
2004 ◽  
Vol 88 (10) ◽  
pp. 1164-1164 ◽  
Author(s):  
I. Fekih Hassen ◽  
J. Kummert ◽  
S. Marbot ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Plant Pathogens ◽  
Prunus Persica ◽  
Fruit Trees ◽  
Pcr Analysis ◽  
Economic Damage ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Italian Isolate ◽  
Pear Trees

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

scholarly journals Brewing and Probiotic Potential Activity of Wild Yeasts Hanseniaspora Uvarum PIT001, Pichia Kluyveri LAR001 and Candida Intermedia ORQ001

2021 ◽  
Author(s):  
Renan Eugênio Araujo Piraine ◽  
Gustavo M Retzlaf ◽  
Vitória S. Gonçalves ◽  
Rodrigo C Cunha ◽  
Fabio Pereira Leivas Leite
Keyword(s):  
Pathogenic Bacteria ◽  
Inhibitory Effect ◽  
Starter Cultures ◽  
Mixed Fermentation ◽  
Candida Intermedia ◽  
Probiotic Potential ◽  
Hanseniaspora Uvarum ◽  
Wide Range ◽  
Pichia Kluyveri

Abstract Non-conventional yeasts can be isolated from a wide range of environmental sources, often found in beverage industry in mixed fermentations, in which the microorganisms’ inoculum usually is not fully known. It is important to know starter cultures, since in addition to favoring reproducibility, other properties can be discovered. Thus, the objective of this work was to identify and characterize yeasts isolated from environment, evaluating their probiotic potential and possible use in brewery. Isolates were obtained from flowers, fruits, leaves and mixed-fermentation beers, being identified by PCR. Yeasts with promising activity were evaluated regarding their growth under different pHs, temperature and presence of organic acids. To explore probiotic potential, in vitro tests were performed of antimicrobial activity and co-aggregation with food pathogens, auto-aggregation, and survival in simulated gastrointestinal tract conditions. In our study, Pichia kluyveri (LAR001), Hanseniaspora uvarum (PIT001) and Candida intermedia (ORQ001) were selected among 20 isolates. P. kluyveri was the only one that tolerated pH 2.5. Lactic acid was not inhibitory, while acetic acid and incubation at 37 °C had a partially inhibitory effect on yeasts growth. All yeasts tolerated α-acids from hops and NaCl up to 1%. It is suggested that isolates are able to adhere to intestinal cells and influence positively the organism in combating pathogens, as they showed auto-aggregation rates above 99% and antagonistic activity to pathogenic bacteria. The yeasts tolerated gastric environment conditions, however were more sensitive to pancreatic conditions. We conclude that isolated non-conventional yeasts showed probiotic potential and promising application in beer fermentation.

Sign in / Sign up

Export Citation Format

Share Document