Heterogeneous taxonomic resolution of cytochrome b gene identification of bats from Argentina: Implications for field studies

Bats are among the most diverse, widespread, and abundant mammals. In Argentina, 67 species of bats have been recorded, belonging to 5 families and 29 genera. These high levels of biodiversity are likely to complicate identification at fieldwork, especially between closely related species, where external morphology-based approaches are the only immediate means for a priori species assignment. The use of molecular markers can enhance species identification, and acquires particular relevance in capture-release studies. In this study, we discuss the extent of the use of the mitochondrial cytochrome b gene for species identification, comparing external morphology identification with a molecular phylogenetic classification based on this marker, under the light of current bat systematics. We analyzed 33 samples collected in an eco-epidemiological survey in the province of Santa Fe (Argentina). We further sequenced 27 museum vouchers to test the accuracy of cytochrome b -based phylogenies in taxonomic identification of bats occurring in the Pampean/Chacoan regions of Argentina. The cytochrome b gene was successfully amplified in all Molossid and Vespertilionid species except for Eptesicus, for which we designed a new reverse primer. The resulting Bayesian phylogeny was congruent with current systematics. Cytochrome b proved useful for species-level delimitation in non-conflicting genera (Eumops, Dasypterus, Molossops) and has infrageneric resolution in more complex lineages (Eptesicus, Myotis, Molossus). We discuss four sources of incongruence that may act separately or in combination: 1) molecular processes, 2) biology, 3) limitations in identification, and 4) errors in the current taxonomy. The present study confirms the general applicability of cytochrome b -based phylogenies in eco-epidemiological studies, but its resolution and reliability depend mainly, but not solely, on the level of genetic differentiation within each bat genus.

Download Full-text

Biological invasions: are they dependent on disturbance?

Environmental Reviews ◽

10.1139/a97-007 ◽

1997 ◽

Vol 5 (2) ◽

pp. 131-144 ◽

Cited By ~ 102

Author(s):

J D Lozon ◽

H J MacIsaac

Keyword(s):

Exotic Species ◽

Human Activities ◽

Water Discharge ◽

A Priori ◽

Terrestrial Ecosystems ◽

Field Studies ◽

Soil Disturbance ◽

Exotic Animals ◽

Introduced Plants ◽

Disturbed Habitats

We utilize literature surveys to examine the relationship between establishment of exotic species and human or natural disturbances of ecosystems. Of the 133 papers published in 10 ecological journals between 1993 and 1995, 63 reported on field studies involving 299 and 103 successful, nonredundant plant and animal introductions, respectively. Invasions of terrestrial ecosystems dominated (>>97%) the surveyed literature. Disturbance was associated with establishment of exotic species in 56% of these studies, though its importance differed among papers describing plants (68%) and animals (28%). Plants species (86%) were significantly more dependent on disturbance for establishment than were animals (12%). However, animals and plants that were dependent on disturbance for establishment were almost equally dependent (58 versus 68%) on it for range expansion. In a second survey, 402 plant and 103 animal taxa were identified that explicitly linked establishment of exotic species to disturbance. Human activities were attributed with establishment of species in 97 and 57% of these cases, respectively. Common mechanisms associated with establishment of exotic animals included ballast water discharge, intentional releases, and residential development. Establishment of exotic plants was associated with animal activities (e.g., grazing, seed introduction), soil disturbance, forestry, fire, agriculture, and human activities. In contrast to invasions theory, our survey indicates that the association between establishment and spread of exotic species and disturbance ought not be assumed a priori. Some animals repeatedly invade new habitats once geographic barriers are circumvented, indicating that communities may be more receptive to exotic species than previously acknowledged. By contrast, introduced plants established most often in disturbed habitats.

Download Full-text

Pilaira australis sp. nov. (Mucorales, Mucoromycota) isolated from emu faeces in Australia

Phytotaxa ◽

10.11646/phytotaxa.329.3.9 ◽

2017 ◽

Vol 329 (3) ◽

pp. 277 ◽

Cited By ~ 3

Author(s):

ANDREW S. URQUHART ◽

PAULINE M. L. COULON ◽

ALEXANDER IDNURM

Keyword(s):

Phylogenetic Analysis ◽

New Species ◽

Species Identification ◽

Internal Transcribed Spacers ◽

Molecular Phylogenetic Analysis ◽

Unique Combination ◽

Dromaius Novaehollandiae ◽

Molecular Phylogenetic ◽

Carbon Utilisation ◽

A New Species

Pilaira australis, a new species of fungus in the coprophilous genus Pilaira, was isolated from emu (Dromaius novaehollandiae) faeces and is described. Morphologically, the species resembles other species in the genus, particularly P. moreaui, except differs in its unique combination of sporangiophore height and sporangiospore length. Molecular phylogenetic analysis indicates that P. australis is distinct from other species in the genus with two regions, the internal transcribed spacers (ITS) and a fragment of the pyrG gene, showing 91% and 90% identity to the nearest species, respectively. Ultrastructure features and carbon utilisation were determined for P. australis, and may provide characteristics for species identification in this genus.

Download Full-text

Ergonomic Evaluation of Current Advancements in Blueberry Harvesting

Agronomy ◽

10.3390/agronomy8110266 ◽

2018 ◽

Vol 8 (11) ◽

pp. 266 ◽

Cited By ~ 8

Author(s):

Eunsik Kim ◽

Andris Freivalds ◽

Fumiomi Takeda ◽

Changying Li

Keyword(s):

Occupational Safety ◽

Health And Safety ◽

Field Studies ◽

The United States ◽

Epidemiological Studies ◽

Component Ratio ◽

Social Scientists ◽

Private Industry ◽

Work Related ◽

Trauma Disorders

Work-related musculoskeletal disorders (MSDs) accounted for 32% of days-away-from-work cases in private industry in 2016. Several factors have been associated with MSDs, such as repetitive motion, excessive force, awkward and/or sustained postures, and prolonged sitting and standing, all of which are required in farm workers’ labor. While numerous epidemiological studies on the prevention of MSDs in agriculture have been conducted, an ergonomics evaluation of blueberry harvesting has not yet been systematically performed. The purpose of this study was to investigate the risk factors of MSDs for several types of blueberry harvesting (hand harvesting, semi-mechanical harvesting with hand-held shakers, and over-the-row machines) in terms of workers’ postural loads and self-reported discomfort using ergonomics intervention techniques. Five field studies in the western region of the United States between 2017 and 2018 were conducted using the Borg CR10 scale, electromyography (EMG), Rapid Upper Limb Assessment (RULA), the Cumulative Trauma Disorders (CTD) index, and the NIOSH (National Institute for Occupational Safety and Health) lifting equation. In evaluating the workloads of picking and moving blueberries by hand, semi-mechanical harvesting with hand-held shakers, and completely mechanized harvesting, only EMG and the NIOSH lifting equation were used, as labor for this system is limited to loading empty lugs and unloading full lugs. Based on the results, we conclude that working on the fully mechanized harvester would be the best approach to minimizing worker loading and fatigue. This is because the total component ratio of postures in hand harvesting with a RULA score equal to or greater than 5 was 69%, indicating that more than half of the postures were high risk for shoulder pain. For the semi-mechanical harvesting, the biggest problem with the shakers is the vibration, which can cause fatigue and various risks to workers, especially in the upper limbs. However, it would be challenging for small- and medium-sized blueberry farms to purchase automated harvesters due to their high cost. Thus, collaborative efforts among health and safety professionals, engineers, social scientists, and ergonomists are needed to provide effective ergonomic interventions.

Download Full-text

New records of the William’s Jerboa, Paralactaga cf. williamsi (Thomas, 1897) (Rodentia: Dipodidae) from northeastern Iran with notes on its ecology

Check List ◽

10.15560/12.2.1855 ◽

2016 ◽

Vol 12 (2) ◽

pp. 1855 ◽

Cited By ~ 5

Author(s):

Kordiyeh Hamidi ◽

Jamshid Darvish ◽

Maryam M. Matin

Keyword(s):

Species Identification ◽

Cytochrome B ◽

New Record ◽

New Records ◽

Taxonomic Status ◽

First Record ◽

External Morphology ◽

Western Iran ◽

Eastern Iran ◽

Molar Teeth

Paralactaga williamsi, a five-toed jerboa, is known to occur in Anatolian Turkey, northern Lebanon, Armenia, Azerbaijan and western Iran. Here, we report the first record of this species in Kopet-Dag Mountains, northeastern Iran. Species identification was based on external morphology, skull and molar teeth morphology and morphometrics studies, as well as molecular analyses. Brief notes on the ecology of the species are also provided. This new record expands the distribution of P. williamsi in Iran about 850 km eastward, however further sampling will be needed for a better judgment on the taxonomic status of this species in eastern Iran and to determine the patterns of its distribution. Since the specimen did not group with other P. williamsi in the cytochrome b analysis, we provisionally classify the specimens as P. cf. williamsi.

Download Full-text

A Review of A Priori Defined Oxidative Balance Scores Relative to Their Components and Impact on Health Outcomes

Nutrients ◽

10.3390/nu11040774 ◽

2019 ◽

Vol 11 (4) ◽

pp. 774 ◽

Cited By ~ 2

Author(s):

Ángela Hernández-Ruiz ◽

Belén García-Villanova ◽

Eduardo Guerra-Hernández ◽

Pilar Amiano ◽

Miguel Ruiz-Canela ◽

...

Keyword(s):

Health Outcomes ◽

A Priori ◽

Epidemiological Studies ◽

Dietary Factors ◽

Colorectal Adenomas ◽

Adverse Health Outcomes ◽

Oxidative Balance ◽

Oxidation Reduction ◽

Great Heterogeneity ◽

Definition Of

Oxidative Balance Scores (OBSs) are tools that have emerged to evaluate the global balance of individuals’ oxidation—reduction status. The aim was to compare OBSs available in the literature regarding their characteristics and associations with chronic diseases in epidemiological studies. Studies that developed OBSs were searched in PubMed until August 2018. A total of 21 OBSs were identified. These OBSs presented different scoring schemes and different types of anti- and pro-oxidant components, including dietary factors (dietary intake and/or nutrient biomarkers), lifestyle factors, and medications. Most OBSs were based on over 10 components, and some included only dietary factors. Few considered weighted components in the score. Only three OBSs were validated as potential surrogates of oxidative balance through inflammation and OS-related biomarkers. Notably, all the OBSs were associated—to a varying degree—with a reduced risk of cardiovascular diseases, chronic kidney disease, colorectal adenomas, and different cancer types (colorectal and breast cancer), as well as with all-cause and cancer-related mortality. For other outcomes, e.g., prostate cancer, contradictory results were reported. In summary, there is a great heterogeneity in the definition of OBSs. Most studies are concordant in supporting that excessive OS reflected by a lower OBS has deleterious effects on health. Unified criteria for defining the proper OBSs, valuable to gauge OS-related aspects of the diet and lifestyle that may lead to adverse health outcomes, are needed.

Download Full-text

A new Indo-Malayan family of Grassatores (Arachnida : Opiliones : Laniatores)

Invertebrate Systematics ◽

10.1071/is19035 ◽

2019 ◽

Vol 33 (6) ◽

pp. 892

Author(s):

Adriano B. Kury ◽

Abel Pérez-González ◽

Daniel N. Proud

Keyword(s):

Phylogenetic Analysis ◽

East Asia ◽

Male Genitalia ◽

Broad Context ◽

External Morphology ◽

Molecular Phylogenetic Analysis ◽

South East Asia ◽

New Family ◽

The Family ◽

Molecular Phylogenetic

The laniatorean family Phalangodidae has been largely reduced to a core of Holarctic species; however, many taxa were never formally transferred to other families. We examined a group of harvestmen related to Beloniscus Thorell, 1891, from South-east Asia and determined the nature of the relationships of the ‘Beloniscus-like harvestmen’, herein described as the new family Beloniscidae, fam. nov., in the broad context of Laniatores. Based on a molecular phylogenetic analysis of a broad representative laniatorean Sanger-sequences dataset we found support for our taxonomic hypotheses that (1) inclusion of Beloniscidae, fam. nov. in Phalangodidae would render the family non-monophyletic, and (2) Beloniscidae, fam. nov. represents a lineage that is morphologically and genetically distinct from all other known laniatorean families. The new family Beloniscidae is endemic to South-east Asia and comprises 37 species in two new subfamilies: Beloniscinae, subfam. nov. and Buparinae, subfam. nov. Beloniscinae includes the genera Beloniscellus Roewer, 1931, Beloniscops Roewer, 1949, Belonisculus Roewer, 1923, Beloniscus (type genus) and Kendengus Roewer, 1949. Buparinae includes the genera Buparellus Roewer, 1949, Bupares Thorell, 1889 (type genus) and Buparomma Roewer, 1949. Members of Beloniscidae are relatively homogeneous in their external morphology, but are recognised by well marked genitalic features. Male genitalia are described for exemplar species, and the morphology is compared with that of Epedanidae. Names are given to two new genitalic structures: sella curulis and pseudocalyx. http://zoobank.org/urn:lsid:zoobank.org:act:540BCE49-6F2E-4372-BFD4-D3C6068F045D http://zoobank.org/urn:lsid:zoobank.org:act:FE8B011B-AA6D-4E6C-A321-123542A0563F http://zoobank.org/urn:lsid:zoobank.org:act:E4A559CD-170A-40F2-924A-541C22974344

Download Full-text

Patterns of food consumption among vegetarians and non-vegetarians

British Journal Of Nutrition ◽

10.1017/s000711451400261x ◽

2014 ◽

Vol 112 (10) ◽

pp. 1644-1653 ◽

Cited By ~ 68

Author(s):

Michael J. Orlich ◽

Karen Jaceldo-Siegl ◽

Joan Sabaté ◽

Jing Fan ◽

Pramil N. Singh ◽

...

Keyword(s):

Health Outcomes ◽

Food Consumption ◽

Dietary Patterns ◽

A Priori ◽

Food Group ◽

Epidemiological Studies ◽

Consumption Patterns ◽

Health Study ◽

Food Groups ◽

Vegetarian Diets

Vegetarian dietary patterns have been reported to be associated with a number of favourable health outcomes in epidemiological studies, including the Adventist Health Study 2 (AHS-2). Such dietary patterns may vary and need further characterisation regarding foods consumed. The aims of the present study were to characterise and compare the food consumption patterns of several vegetarian and non-vegetarian diets. Dietary intake was measured using an FFQ among more than 89 000 members of the AHS-2 cohort. Vegetarian dietary patterns were defined a priori, based on the absence of certain animal foods in the diet. Foods were categorised into fifty-eight minor food groups comprising seventeen major food groups. The adjusted mean consumption of each food group for the vegetarian dietary patterns was compared with that for the non-vegetarian dietary pattern. Mean consumption was found to differ significantly across the dietary patterns for all food groups. Increased consumption of many plant foods including fruits, vegetables, avocados, non-fried potatoes, whole grains, legumes, soya foods, nuts and seeds was observed among vegetarians. Conversely, reduced consumption of meats, dairy products, eggs, refined grains, added fats, sweets, snack foods and non-water beverages was observed among vegetarians. Thus, although vegetarian dietary patterns in the AHS-2 have been defined based on the absence of animal foods in the diet, they differ greatly with respect to the consumption of many other food groups. These differences in food consumption patterns may be important in helping to explain the association of vegetarian diets with several important health outcomes.

Download Full-text

Protocol for Specific Isolation of Virulent Strains of Vibrio vulnificus Serovar E (Biotype 2) from Environmental Samples

Applied and Environmental Microbiology ◽

10.1128/aem.70.12.7024-7032.2004 ◽

2004 ◽

Vol 70 (12) ◽

pp. 7024-7032 ◽

Cited By ~ 21

Author(s):

Eva Sanjuán ◽

Carmen Amaro

Keyword(s):

Environmental Samples ◽

Vibrio Vulnificus ◽

Growth Yield ◽

Field Studies ◽

Epidemiological Studies ◽

Alkaline Peptone Water ◽

Virulent Strains ◽

Peptone Water ◽

Human Sera ◽

Human Infections

ABSTRACT The eel pathogen Vibrio vulnificus biotype 2 comprises at least three serovars, with serovar E being the only one involved in both epizootics of eel vibriosis and sporadic cases of human infections. The virulent strains of this serovar (VSE) have only been recovered from clinical (mainly eel tissue) sources. The main objective of this work was to design and validate a new protocol for VSE-specific isolation from environmental samples. The key element of the new protocol is the broth used for the first step (saline eel serum broth [SEB]), which contains eel serum as a nutritive and selective component. This approach takes advantage of the ability of VSE cells to grow in eel serum and thus to separate themselves from the pool of competitors. The growth yield in SEB after 8 h of incubation was 1,000 times higher for VSE strains than for their putative competitors (including biotype 1 strains of the species). The selective and differential agar Vibrio vulnificus medium (VVM) was selected from five selective media for the second step because it gave the highest plating efficiency not only for the VSE group but also for other V. vulnificus groups, including biotype 3. The entire protocol was validated by field studies, with alkaline peptone water plus VVM as a control. V. vulnificus was isolated by both protocols, but serovar E was only recovered by the new method described here. All selected serovar E isolates were identified as VSE since they were virulent for both eels and iron-overloaded mice and resisted the bactericidal action of eel and iron-overloaded human sera. In conclusion, this new protocol is a suitable method for the isolation of VSE strains from environmental samples and is recommended for epidemiological studies of the pathogenic serovar E.

Download Full-text

Taxonomic Revision of Tynanthus (Bignonieae, Bignoniaceae)

Phytotaxa ◽

10.11646/phytotaxa.216.1.1 ◽

2015 ◽

Vol 216 (1) ◽

pp. 1 ◽

Cited By ~ 2

Author(s):

Maria Cláudia Melo Pacheco de Medeiros ◽

Lúcia Garcez Lohmann

Keyword(s):

Taxonomic Revision ◽

Field Studies ◽

Identification Key ◽

Complete List ◽

Southern Brazil ◽

Southern Mexico ◽

Phenological Data ◽

Detailed Treatment ◽

Molecular Phylogenetic ◽

Molecular Phylogenetic Data

Tynanthus is a genus of Neotropical lianas that are distributed from southern Mexico to southern Brazil. Extensive herbarium work, field studies and new molecular phylogenetic data were used as the basis to recognize 14 species in the genus. Here, we provide a detailed treatment of the group, including an identification key to all species recognized, as well as morphological descriptions, a complete list of synonymy, nomenclatural information, taxonomic notes, phenological data, information on habitat and distribution, and illustrations. Two species are circumscribed differently from earlier classifications, in particular Tynanthus elegans is synonymized with Tynanthus cognatus, while Tynanthus villosus is synonymized with Tynanthus polyanthus. In addition, Tynanthus goudotianus is treated as a doubtful name, and two recently described species are recognized, Tynanthus densiflorus and Tynanthus espiritosantensis. One species name is neotypified, Tynanthus caryophylleus, and nine species names are lectotypified, namely Cuspidaria ovalis, Tynanthus cognatus, Tynanthus elegans, Tynanthus guatemalensis, Tynanthus lindmanii, Tynanthus myrianthus, Tynanthus panurensis, Schizopsis chimonantha, and Schizopsis regnelliana. A complete list of doubtful and excluded names is presented.

Download Full-text

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus)

The Iraqi Journal of Veterinary Medicine ◽

10.30539/iraqijvm.v42i1.34 ◽

2018 ◽

Vol 42 (1) ◽

pp. 72-78

Author(s):

Karim Sadun Ali Al-Ajeeli

Keyword(s):

Polymerase Chain Reaction ◽

Molecular Detection ◽

Clinical Signs ◽

Epidemiological Studies ◽

Buffy Coat ◽

Chain Reaction ◽

Cervical Lymph Nodes ◽

Equus Asinus ◽

Reverse Primer ◽

Polymerase Chain

Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5’ TAACTGAGATCT AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.

Download Full-text