Identification of Cotton F1 Hybrids and their Parents through Molecular Marker under Salinity Stress

An experiment was carried out at Main Cotton Research Station, NAU, Surat, Gujarat, India during 2018–2020 to identify F1 hybrids and their parents through SSR marker for salinity tolerance in cotton. The four cotton parents (two salt tolerant and two salt sensitive) were crossed in a diallel fashion to obtain twelve cotton hybrids and subjected to DNA isolation and PCR amplification with SSR markers. In the present study, six SSR markers (TMB0409, DPL0094, BNL686, JESPR153, CM45 and MGHES006) were identified to be polymorphic between parents and the hybrids. The SSR primer TMB0409, DPL0094, JESPR153 and CM45 identified two fragments each from different parents in two, two, four and eight cotton hybrids, respectively, which confirmed true hybrids. Hence, the SSR molecular marker, individually or in combination can be used to distinguish and confirm the hybrid and parents in cotton with special reference to salinity. The PCA analysis revealed that BNL686–1 (248 bp) allele contributed significantly to the quantum of variation as explained by PC1. Hence, this allele is able to serve as a benchmark for ascertaining the efficient pattern of grouping between genotypes. Further, the marker CM45 amplified a fragment specific to the saline tolerant parents which was absent in sensitive parents as well as a fragment produced in sensitive parent which was absent in the tolerant parents, hence the molecular marker CM45 may associate with the salinity tolerance in cotton and can be used for salinity tolerant breeding program after confirming in a large population.

Download Full-text

PCR identification of Petunia male sterile cytoplasm

Ornamental Horticulture ◽

10.1590/2447-536x.v25i4.2069 ◽

2019 ◽

Vol 25 (4) ◽

pp. 345-350

Author(s):

Noemí Colombo ◽

Juan Carlos Hagiwara

Keyword(s):

Molecular Marker ◽

Pcr Amplification ◽

Flower Colour ◽

Positive Control ◽

F1 Hybrids ◽

Male Sterile ◽

Mother Plants ◽

Self Fertilization ◽

Male Sterile Cytoplasm ◽

Set Up

Abstract Petunia is a very important ornamental plant with a broad range of flower colour and size, and most of the cultivars grown are propagated through seeds. Cytoplasmic male sterility (CMS) is a maternally inherited character determined by mitochondrial genes that results in impaired pollen development. The unique and well characterized male sterile cytoplasm in Petunia is a valuable resource for hybrids production because it prevents self-fertilization of mother plants and ensures the purity of F1s. Introgression of the male sterile cytoplasm in elite lines of Petunia is achieved following a backcross scheme and can be assisted using molecular markers associated to the trait of interest. The objective of this study was to develop a molecular marker to identify the male sterile cytoplasm of Petunia. A PCR-based marker amplifying a region of the mitochondrial CMS-associated urfS only in the male sterile plants was designed. Results showed differential PCR amplification of a ≈ 600 bp product in plants carrying male sterile cytoplasm in four Petunia species and their F1s and BC1 generations. A multiplex PCR reaction was subsequently set up, adding specific primers amplifying a ≈ 800 bp product from the conserved region trnT-trn-L of the chloroplast genome as a positive control in order to unambiguously identify the cytoplasm types as normal or sterile. A rapid, simple and precise molecular marker is now available for assisting breeding of F1 hybrids in Petunia.

Download Full-text

GENETIC RELATIONSHIPS AMONG PISTACIA VERA L. F1 HYBRIDS AND THEIR PARENTS (P. VERA×HERMAPHRODITE GENOTYPES OF P. ATLANTICA) USING SSR MARKERS

AGROFOR ◽

10.7251/agreng1902028a ◽

2021 ◽

Vol 4 (2) ◽

Author(s):

Najwa M. ALHAJJAR ◽

Bayan M. MUZHER

Keyword(s):

Ssr Markers ◽

Agricultural Research ◽

Genetic Relationships ◽

Pcr Amplification ◽

Pollen Grains ◽

Female Parent ◽

Sex Expression ◽

F1 Hybrids ◽

Breeding Programs ◽

Ssr Analysis

This research was conducted at the Scientific Agricultural Research center in Sweida province during (2014-2015). Breeding program was assessed in the aim to insert the bisexual phenomena of P.atlantica species (3 different hermaphrodite genotypes PA12, PA35, and PA37 as donators of pollen grains) to the commercial cultivars of P.vera (Ashouri and Batouri). Genetic relationships among the previous species and their progenies (F1, 6 genotypes of crossing program) was studied using 20 specific SSRs primer pairs, 16 of them were able to detect PCR amplification. Simple Sequence Repeat (SSR) segregation produced 44 putative alleles, out of which 40 were polymorphic (90.91%). Genetic similarity between the hybrids and their parents were closer to their female than to their male parents except for the hybrid HB3,which revealed a genetic distance 0.37 with its female parent (Batouri cultivar FB) and 0.43 with its male parent (PA35 hermaphrodite P.atlantica genotype). The UPGMA cluster plots based on Jaccard’s coefficient grouped the genotypes into two main clusters. The number of alleles revealed by each SSR analysis ranged from 1 to 8, with a level of expected heterozygosity (He) 0.496, observed heterozygosity (Ho) 0.25, and Marker Index (MI) 19.84. These results suggested the efficiency of SSR markers for distinguishing lineage genetic studies in the Pistacia spp. in breeding programs to elicit new cultivars, in particularly the primer pairs Ptms-7, EPVM021, EPVM016, and EPVF019 which may form the platform to detect sex expression in the genus Pistacia.

Download Full-text

Application of SSR Technique for the Identification of Markers Linked to Salinity Tolerance in Rice

Progressive Agriculture ◽

10.3329/pa.v19i2.16929 ◽

2013 ◽

Vol 19 (2) ◽

pp. 57-65

Author(s):

MH Kabir ◽

MM Islam ◽

SN Begum ◽

AC Manidas

Keyword(s):

Salt Tolerance ◽

Ssr Markers ◽

Salinity Tolerance ◽

Seedling Stage ◽

Phenotypic Screening ◽

Salt Tolerant ◽

Marker Assisted Breeding ◽

Hydroponic System ◽

Rice Landrace ◽

Salt Susceptible

A cross was made between high yielding salt susceptible BINA variety (Binadhan-5) with salt tolerant rice landrace (Harkuch) to identify salt tolerant rice lines. Thirty six F3 rice lines of Binadhan-5 x Harkuch were tested for salinity tolerance at the seedling stage in hydroponic system using nutrient solution. In F3 population, six lines were found as salt tolerant and 10 lines were moderately tolerant based on phenotypic screening at the seedling stage. Twelve SSR markers were used for parental survey and among them three polymorphic SSR markers viz., OSR34, RM443 and RM169 were selected to evaluate 26 F3 rice lines for salt tolerance. With respect to marker OSR34, 15 lines were identified as salt tolerant, 9 lines were susceptible and 2 lines were heterozygous. While RM443 identified 3 tolerant, 14 susceptible and 9 heterozygous rice lines. Eight tolerant, 11 susceptible and 7 heterozygous lines were identified with the marker RM169. Thus the tested markers could be efficiently used for tagging salt tolerant genes in marker-assisted breeding programme.DOI: http://dx.doi.org/10.3329/pa.v19i2.16929 Progress. Agric. 19(2): 57 - 65, 2008

Download Full-text

Microsatellite Marker: Importance and Implications of Cross-genome Analysis for Finger Millet (Eleusine coracana (L.) Gaertn)

Current Biotechnology ◽

10.2174/2211550109999200908090745 ◽

2020 ◽

Vol 9 (3) ◽

pp. 160-170

Author(s):

Thumadath P.A. Krishna ◽

Maharajan Theivanayagam ◽

Gurusunathan V. Roch ◽

Veeramuthu Duraipandiyan ◽

Savarimuthu Ignacimuthu

Keyword(s):

Molecular Marker ◽

Microsatellite Markers ◽

Ssr Markers ◽

Genome Analysis ◽

Related Species ◽

Finger Millet ◽

Crop Improvement ◽

Human Beings ◽

Closely Related Species ◽

Genome Amplification

Finger millet is a superior staple food for human beings. Microsatellite or Simple Sequence Repeat (SSR) marker is a powerful tool for genetic mapping, diversity analysis and plant breeding. In finger millet, microsatellites show a higher level of polymorphism than other molecular marker systems. The identification and development of microsatellite markers are extremely expensive and time-consuming. Only less than 50% of SSR markers have been developed from microsatellite sequences for finger millet. Therefore, it is important to transfer SSR markers developed for related species/genus to finger millet. Cross-genome transferability is the easiest and cheapest method to develop SSR markers. Many comparative mapping studies using microsatellite markers clearly revealed the presence of synteny within the genomes of closely related species/ genus. Sufficient homology exists among several crop plant genomes in the sequences flanking the SSR loci. Thus, the SSR markers are beneficial to amplify the target regions in the finger millet genome. Many SSR markers were used for the analysis of cross-genome amplification in various plants such as Setaria italica, Pennisetum glaucum, Oryza sativa, Triticum aestivum, Zea mays and Hordeum vulgare. However, there is very little information available about cross-genome amplification of these markers in finger millet. The only limited report is available for the utilization of cross-genome amplified microsatellite markers in genetic analysis, gene mapping and other applications in finger millet. This review highlights the importance and implication of microsatellite markers such as genomic SSR (gSSR) and Expressed Sequence Tag (EST)-SSR in cross-genome analysis in finger millet. Nowadays, crop improvement has been one of the major priority areas of research in agriculture. The genome assisted breeding and genetic engineering plays a very crucial role in enhancing crop productivity. The rapid advance in molecular marker technology is helpful for crop improvement. Therefore, this review will be very helpful to the researchers for understanding the importance and implication of SSR markers in closely related species.

Download Full-text

Next Generation Sequencing-Based Molecular Marker Development: A Case Study in Betula Alnoides

Molecules ◽

10.3390/molecules23112963 ◽

2018 ◽

Vol 23 (11) ◽

pp. 2963 ◽

Cited By ~ 3

Author(s):

Jing Tan ◽

Jun-Jie Guo ◽

Ming-Yu Yin ◽

Huan Wang ◽

Wen-Pan Dong ◽

...

Keyword(s):

Next Generation Sequencing ◽

Molecular Marker ◽

Ssr Markers ◽

Southern China ◽

Diversity Index ◽

Next Generation ◽

Wiener Diversity Index ◽

Nucleotide Repeats ◽

Betula Alnoides ◽

Generation Sequencing

Betula alnoides is a fast-growing valuable indigenous tree species with multiple uses in the tropical and warm subtropical regions in South-East Asia and southern China. It has been proved to be tetraploid in most parts of its distribution in China. In the present study, next generation sequencing (NGS) technology was applied to develop numerous SSR markers for B. alnoides, and 64,376 contig sequences of 106,452 clean reads containing 164,357 candidate SSR loci were obtained. Among the derived SSR repeats, mono-nucleotide was the main type (77.05%), followed by di- (10.18%), tetra- (6.12%), tri- (3.56%), penta- (2.14%) and hexa-nucleotide (0.95%). The short nucleotide sequence repeats accounted for 90.79%. Among the 291 repeat motifs, AG/CT (46.33%) and AT/AT (44.15%) were the most common di-nucleotide repeats, while AAT/ATT (48.98%) was the most common tri-nucleotide repeats. A total of 2549 primer sets were designed from the identified putative SSR regions of which 900 were randomly selected for evaluation of amplification successfulness and detection of polymorphism if amplified successfully. Three hundred and ten polymorphic markers were obtained through testing with 24 individuals from B. alnoides natural forest in Jingxi County, Guangxi, China. The number of alleles (NA) of each marker ranged from 2 to 19 with a mean of 5.14. The observed (HO) and expected (HE) heterozygosities varied from 0.04 to 1.00 and 0.04 to 0.92 with their means being 0.64 and 0.57, respectively. Shannon-Wiener diversity index (I) ranged from 0.10 to 2.68 with a mean of 1.12. Cross-species transferability was further examined for 96 pairs of SSR primers randomly selected, and it was found that 48.96–84.38% of the primer pairs could successfully amplify each of six related Betula species. The obtained SSR markers can be used to study population genetics and molecular marker assisted breeding, particularly genome-wide association study of these species in the future.

Download Full-text

Method Comparison of DNA Isolation and Quantification for Fish and Seafood Authenticity Determination

SQUALEN Bulletin of Marine and Fisheries Postharvest and Biotechnology ◽

10.15578/squalen.v13i3.370 ◽

2018 ◽

Vol 13 (3) ◽

pp. 115

Author(s):

Dwiyitno Dwiyitno ◽

Stefan Hoffman ◽

Koen Parmentier ◽

Chris Van Keer

Keyword(s):

Polymerase Chain Reaction ◽

Dna Extraction ◽

Dna Isolation ◽

Blue Mussel ◽

Pcr Amplification ◽

Amplification Efficiency ◽

Chain Reaction ◽

Seafood Products ◽

Polymerase Chain ◽

Commercial Kit

Fish and seafood products has been commonly targeted for fraudulent activities. For that reason, authentication of fish and seafood products is important to protect consumers from fraudulent and adulteration practices, as well as to implement traceability regulation. From the viewpoint of food safety, authenticity is beneficial to protect public from serious food poisoning incidents, such as due to ingestion of toxic species. Since DNA based identification depends on the nucleic acid polymerase chain reaction (PCR), the quantity and quality/purity of DNA will contribute significantly to the species authentication. In the present study, different DNA extraction and purification methods (3 classical methods and one commercial kit) were compared to produce the better isolated DNA for PCR amplification. Additionally, different methods for the estimation of DNA concentration and purity which is essential for PCR amplification efficiency were also evaluated. The result showed that classical DNA extraction methods (based on TNES-Urea) yielded a higher amount of DNA (11.30-323.60 ng/g tissue) in comparison to commercial kit/Wizard Promega (5.70-83.45 ng/g tissue). Based on the purity of DNA extract (A260/280), classical DNA extraction method produced relatively similar on DNA quality to the commercial kit (1.79-2.12). Interestingly, all classical methods produced DNA with A260/280 ratio of more than 2.00 on the blue mussel, in contrast with commercial kit. The commercial kit also produced better quality of DNA compared to the classical methods, showing the higher efficiency in PCR amplification. NanoDrop is promising as cheap, robust and safe UV-spectrophotometer method for DNA quantification, as well as the purity evaluation.Keywords: seafood authenticity, DNA isolation, polymerase chain reaction, NanoDrop, Picogreen

Download Full-text

Gene Action Studies in the Inheritance of Yield and Quality Attributing Traits in Diallel Cross of Cotton (Gossypium hirsutum L.)

Indian Journal of Pure & Applied Biosciences ◽

10.18782/2582-2845.8713 ◽

2021 ◽

Vol 9 (3) ◽

pp. 105-109

Author(s):

V. J. Zapadiya ◽

Keyword(s):

Plant Height ◽

Block Design ◽

F1 Hybrids ◽

Research Station ◽

Cotton Yield ◽

Seed Cotton ◽

Gene Effects ◽

Partial Dominance ◽

Seed Cotton Yield ◽

Genetic Components

A field experiment was conducted to evaluate the 45 F1 hybrids derived from 10×10 half diallel fashion along with ten parents and one standard check GN.Cot.Hy-14 were sown in randomized block design with three replications during kharif -2017 at Cotton Research Station, Junagadh Agricultural University, Junagadh. The genetic components of variation were determined for 12 characters viz., days to 50% flowering, days to 50% boll opening, plant height (cm), number of monopodia per plant, number of sympodia per plant, number of bolls per plant, boll weight (g), seed cotton yield per plant (g), ginning percentage (%), seed index (g), lint index (g) and oil percentage (%).The estimate of the components of variation revealed significant results for both additive (D) as well as dominance effects (H1 and H2) for all the characters except plant height non-significant H2 component, but in majority of traits (except plant height, lint index) H1 was higher than D indicating dominance components were important in the inheritance of seed cotton yield and its components. The average degree of dominance (H1/D)1/2 was found to be more than unity for all the traits (except plant height, number of monopodia per plant and lint index indicating partial dominance) indicating over dominance. Asymmetrical distribution of positive and negative genes in the parents was observed for all the traits. High estimates of heritability in narrow sense was observed for days to 50% flowering, days to 50 % boll bursting, number of monopodia per plant, ginning percentage (%), lint index (g) and oil content (%) suggesting that selection based on these attribute would lead to rapid improvement. Due to preponderance of non-additive gene effects of seed cotton yield per plant and most of its component traits, heterosis breeding would also be practically feasible in cotton.

Download Full-text

ANALISIS KERAGAMAN GENETIK PLASMA NUTFAH KAKAO (Theobroma cacaoL.) BERDASARKANMARKA SSR / Analysis of Genetic Variability Germplasm of Cacao (Theobroma cacaoL.)Basedon SSR Marker

Jurnal Penelitian Tanaman Industri ◽

10.21082/jlittri.v17n4.2011.156-162 ◽

2020 ◽

Vol 17 (4) ◽

pp. 156

Author(s):

Surti Kurniasih ◽

Rubiyo Rubiyo ◽

Asep Setiawan ◽

Agus Purwantara ◽

Sudarsono Sudarsono

Keyword(s):

Genetic Diversity ◽

Genetic Distance ◽

Ssr Markers ◽

Theobroma Cacao ◽

Simple Sequence Repeat ◽

Ssr Marker ◽

Gene Diversity ◽

Sequence Repeat ◽

Theobroma Cacao L ◽

Simple Sequence

Microsatellite or simple sequence repeat (SSR) markers have proven to be an excellent tool for cultivar identification, pedigree analysis, and genetic distance evaluations among organisms. The objectives of this research were to characterize cacao collection of Indonesian Coffee and Cacao Research Institute (ICCRI) and to analyze their genetic diversity using SSR markers. In this research, 39 SSR primer pairs were used to amplify genomic DNA of 29 cacao clones. Amplified SSR fragments for each primer pair were scored as individual band and used to determine genetic distance among evaluated cacao clones. Results of the experiment indicated that all SSR primer pairs evaluated were able to produce SSR markers for 29 cacao clones. The results also indicated that 34 out of 39 microsatellite loci evaluated were polymorphic, while 5 others were monomorphic. The total number of observed alleles among 29 clones was 132. Number of alleles per locus ranged from 4-8, with an average of 5.5 alelles per locus. Results of data analysis indicated that the PIC value was 0.665, the observed heterozigosity (Ho) was 0.651, and the gene diversity (He) was 0.720. The PIC, Ho, and He values were considered high. Genetic distances were evaluated using NTSys version 2.1 and dendrogram was constructed. Results of analysis indicated that 12 cacao clones evaluated were clustered in the first group with diversity coefficient of < 3.75. Nine cacao clones were in the second group but with the same value of diversity coefficient (<7.50). The rest of the cacao clones were in the third group with diversity coefficient of>7.50. Based on those finding, all SSR primer pairs evaluated could be used to analyze cacao genome and be useful for genetic diversity analysis of cacao germplasm. The SSR marker analysis in ICCRI cacao collections resulted in high PIC, high observed heterozygosity, and high genetic diversity.Key words: Theobroma cacao L, microsatelite, molecular marker, genetic diversity, heterozygosity AbstrakMarka mikrosatelit atau sekuens sederhana berulang (simple sequence repeat = SSR) terbukti merupakan alat yang bagus untuk identifikasi kultivar, analisis pedigree, dan evaluasi jarak genetik berbagai organisme. Penelitian ini bertujuan untuk:1) karakterisasi kakao koleksi Pusat penelitian Kopi dan Kakao Indonesia menggunakan marka SSR dan 2) analisis keragaman genetik klon-klon kakao koleksi dengan menggunakan marka SSR. Dalam penelitian ini, 39 pasangan primer SSR telah digunakan untuk amplifikasi DNA genomik dari 29 klon kakao. Skoring pita SSR hasil amplifikasi menggunakan masing-masing pasangan primer dilakukan secara terpisah dan digunakan untuk menentukan jarak genetik di antara klon kakao yang dievaluasi. Hasil percobaan menunjukkan bahwa semua pasangan primer SSR yang digunakan mampu menghasilkan pita DNA hasil amplifikasi (marka SSR) untuk 29 klon kakao yang diuji. Hasil penelitian juga menunjukkan bahwa 34 dari 39 lokus SSR yang dianalisis bersifat polimorfik sedangkan lima primer yang lain bersifat monomorfik. Dari 29 klon kakao yang dievaluasi, telah berhasil diamplifikasi sebanyak 132 alel, dengan kisaran antara 4-8 alel/lokus. Rataan jumlah alel per lokus sebanyak 5,50. Hasil analisis data yang dilakukan juga menunjukkan nilai PIC untuk marka SSR yang digunakan sebesar 0,665. Untuk populasi klon kakao yang dievaluasi, diperoleh nilai rataan heterosigositas pengamatan (Ho) sebesar 0,651 dan rataan diversitas gen (He) sebesar 0,720. Nilai PIC Ho dan He yang didapat tergolong tinggi. Berdasarkan analisis keragaman dengan menggunakan program NTSys, diperoleh hasil 12 klon kakao berada dalam grup pertama (koefisien keragaman<3,75) dan9 klon berada dalam grup kedua, dengan koefisien keragaman < 7,50. Sedangkan klon-klon lainnya mempunyai koefisien keragaman > 7,50. Berdasarkan hasil penelitian dan analisis data disimpulkan bahwa marka SSR dapat digunakan untuk menganalisis keragaman genetik plasma nutfah kakao. Tingkat polimorfisme yang dihasilkan marka SSR relatif tinggi. Tingkat heterosigositas plasma nutfah kakao koleksi Puslit Kopi dan Kakao Indonesiarelatif tinggi, dan keragaman genetiknyacukup tinggi.Kata kunci : Theobroma cacao L, mikrosatelit, marka molekuler, keragaman genetik, heterosigositas

Download Full-text

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽

10.21009/bioma13(1).4 ◽

2017 ◽

Vol 13 (1) ◽

pp. 33-36

Author(s):

Rini Puspitaningrum ◽

Ria Amelia ◽

Adisyahputra Adisyahputra

Keyword(s):

Molecular Markers ◽

Glycine Max ◽

Molecular Marker ◽

Pcr Amplification ◽

Housekeeping Gene ◽

Descriptive Study ◽

Gene Fragment ◽

Lectin Gene ◽

Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

Download Full-text

Methods for Detection of Anticarsia gemmatalis Nucleopolyhedrovirus DNA in Soil

Applied and Environmental Microbiology ◽

10.1128/aem.65.6.2307-2311.1999 ◽

1999 ◽

Vol 65 (6) ◽

pp. 2307-2311 ◽

Cited By ~ 17

Author(s):

R. R. de Moraes ◽

J. E. Maruniak ◽

J. E. Funderburk

Keyword(s):

Laboratory Experiments ◽

Dna Isolation ◽

Pcr Amplification ◽

Soil Samples ◽

Anticarsia Gemmatalis ◽

Isolation Method ◽

Viral Dna ◽

Pcr Inhibitors ◽

Magnetic Capture ◽

Pcr Products

ABSTRACT Two methods, phenol-ether and magnetic capture-hybridization (MCH), were developed and compared with regard to their sensitivities and abilities to extract the DNA of the insect baculovirus Anticarsia gemmatalis nucleopolyhedrovirus (AgMNPV) from soil and to produce DNA amplifiable by PCR. Laboratory experiments were performed with 0.25 g of autoclaved soil inoculated with different viral concentrations to optimize both methods of baculovirus DNA extraction and to determine their sensitivities. Both procedures produced amplifiable DNA; however, the MCH method was 100-fold more sensitive than the phenol-ether procedure. The removal of PCR inhibitors from the soil appeared to be complete when MCH was used as the viral DNA isolation method, because undiluted aliquots of the DNA preparations could be amplified by PCR. The phenol-ether procedure probably did not completely remove PCR inhibitors from the soil, since PCR products were observed only when the AgMNPV DNA preparations were diluted 10- or 100-fold. AgMNPV DNA was detected in field-collected soil samples from 15 to 180 days after virus application when the MCH procedure to isolate DNA was coupled with PCR amplification of the polyhedrin region.

Download Full-text