86 EFFECT OF HDAC2 INTERFERENCES ON HISTONE MODIFICATIONS IN MOUSE EARLY EMBRYOS

2013 ◽  
Vol 25 (1) ◽  
pp. 191
Author(s):  
Q. Shen ◽  
Y. Liu ◽  
F. Yin ◽  
L. Yang ◽  
G. Li
Keyword(s):  
Histone Deacetylase ◽  
Transcriptional Repression ◽  
Fluorescent Protein ◽  
Basic Research ◽  
Negative Control ◽  
Immunofluorescent Staining ◽  
Control Group ◽  
Real Time Quantitative Pcr ◽  
Early Embryos ◽  
Transgenic Cells

One of the histone deacetylase members, HDAC2 plays an important role in chromatin remodeling and transcriptional repression. The present study was designed to improve histone acetylations by knocking down the expression of histone deacetylase with RNA interferences. According to the published mouse HDAC2 mRNA sequence (NM_008229.2, GI:87162463), as well as shRNA design principles, 3 interference fragments of 107 to 126 bps, 879 to 898 bps, and 1240 to 1259 bps and a negative control sequence were designed and synthesized, respectively. Four interference vectors expressing a red fluorescent protein were successfully constructed, which were named pCDsRed2-shRNA107, pCDsRed2-shRNA879, pCDsRed2-shRNA1240, and pCDsRed2-shRNAcontrol, respectively. These vectors were then transfected respectively to mouse fetal fibroblast cells. Real-time, quantitative PCR of the transgenic cells showed that the vectors mentioned above resulted in 0.81, 0.73, 0.16, and 0.80 times knockdown of hdac2 expression when compared with the nontransfected cells, which suggested that the piece of 1240 to 1259 bp was the most effective RNAi region. Immunofluorescent staining of the transgenic cells showed that the histone acetylations and methylations of H4K5ac, H3K9ac, H3K9me2, H3K27me3, and H3K4me3 were significantly higher in all of the interference vectors than they were in the negative control. Vector pCDsRed2-shRNA1240 was the most effective RNAi. After injection of pCDsRed2-shRNA1240 into zygote pronuclei, embryos developed to 2-cell, 8-cell embryos and blastocysts decreased to 96.6, 85.3 (P < 0.05), and 35.6 (P < 0.01) of the control group, respectively. High levels of H3K9ac, H4K5ac, H3K4me3, and H3K27me3 were observed in the RNAi embryos when compared with the controls. These results indicated that the knockdown of hdac2 by RNAi decreased the expression of HDAC2 and induced high expression of histone acetylations in both somatic cells and early embryos. This work was supported by the national basic research program of china (No. 2012CB22306).

59 HISTONE DEACETYLASE 1 KNOCK-DOWN IN BOVINE FIBROBLAST CELLS AND CLONED EMBRYOS

2012 ◽  
Vol 24 (1) ◽  
pp. 141
Author(s):  
Z. W. Wang ◽  
P. Zhang ◽  
S. Zhang ◽  
X. Ma ◽  
Y. P. Yin ◽  
...  
Keyword(s):  
Histone Deacetylase ◽  
Nuclear Transfer ◽  
Expression Vector ◽  
Mrna Level ◽  
Negative Control ◽  
Control Group ◽  
Fibroblast Cells ◽  
Control Vector ◽  
Histone Deacetylase 1 ◽  
Donor Cells

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P < 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P > 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P < 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

scholarly journals Dynamic Analysis of Proviral Induction and De Novo Methylation: Implications for a Histone Deacetylase-Independent, Methylation Density-Dependent Mechanism of Transcriptional Repression

2000 ◽  
Vol 20 (3) ◽  
pp. 842-850 ◽  
Author(s):  
Matthew C. Lorincz ◽  
Dirk Schübeler ◽  
Scott C. Goeke ◽  
Mark Walters ◽  
Mark Groudine ◽  
...  
Keyword(s):  
Dna Methylation ◽  
Histone Acetylation ◽  
Histone Deacetylase ◽  
Transcriptional Repression ◽  
Mammalian Cells ◽  
Fluorescent Protein ◽  
De Novo ◽  
Trichostatin A ◽  
Histone Deacetylation ◽  
Over Time

ABSTRACT Methylation of cytosines in the CpG dinucleotide is generally associated with transcriptional repression in mammalian cells, and recent findings implicate histone deacetylation in methylation-mediated repression. Analyses of histone acetylation in in vitro-methylated transfected plasmids support this model; however, little is known about the relationships among de novo DNA methylation, transcriptional repression, and histone acetylation state. To examine these relationships in vivo, we have developed a novel approach that permits the isolation and expansion of cells harboring expressing or silent retroviruses. MEL cells were infected with a Moloney murine leukemia virus encoding the green fluorescent protein (GFP), and single-copy, silent proviral clones were treated weekly with the histone deacetylase inhibitor trichostatin A or the DNA methylation inhibitor 5-azacytidine. Expression was monitored concurrently by flow cytometry, allowing for repeated phenotypic analysis over time, and proviral methylation was determined by Southern blotting and bisulfite methylation mapping. Shortly after infection, proviral expression was inducible and the reporter gene and proviral enhancer showed a low density of methylation. Over time, the efficacy of drug induction diminished, coincident with the accumulation of methyl-CpGs across the provirus. Bisulfite analysis of cells in which 5-azacytidine treatment induced GFP expression revealed measurable but incomplete demethylation of the provirus. Repression could be overcome in late-passage clones only by pretreatment with 5-azacytidine followed by trichostatin A, suggesting that partial demethylation reestablishes the trichostatin-inducible state. These experiments reveal the presence of a silencing mechanism which acts on densely methylated DNA and appears to function independently of histone deacetylase activity.

RNAi analysis of Doublesex1 expression in Daphnia pulex Leydig, 1860 (Cladocera)

Crustaceana ◽  
2019 ◽  
Vol 92 (2) ◽  
pp. 137-154 ◽  
Author(s):  
Chong-Yuan Lin ◽  
Meng-Di Liu ◽  
Xiao-Jing Zhu ◽  
Jun-Jia Ning ◽  
Shan-Liang Xu ◽  
...  
Keyword(s):  
Recombinant Protein ◽  
Fluorescent Protein ◽  
Protein A ◽  
Daphnia Pulex ◽  
Negative Control Group ◽  
Treated Group ◽  
Negative Control ◽  
Control Group ◽  
Blank Control Group ◽  
Rnai Treatment

Abstract To explore the role of the Doublesex gene (Dsx1) in the switching between reproductive modes in Daphnia pulex Leydig, 1860, we performed gene silencing using RNA interference (RNAi). We also investigated the expression of gfp (Green Fluorescent Protein) by quantitative-PCR, and the expression of Dsx1 mRNA after RNAi by real-time PCR. Dsx1 expression was significantly greater in males than in females, and was down-regulated in experimental groups compared with the control group. The decrease was more significant in females (35% of controls) than males (47% of controls). The gene fragment of Dsx1 amplified by PCR was ligated to the pEASY-Blunt vector to obtain the recombinant plasmid expressed recombinant protein induced by isopropyl-β-D-thiogalactoside (IPTG). After having been purified by Ni-column affinity chromatography, the recombinant protein as antigen was used to immune rabbits. The antiserum was successfully purified by the protein A method to obtain the Dsx1 polyclonal antibody, an IgG concentration of 2.65 mg/ml, titer 240 000. Western blotting showed that RNAi treatment significantly reduced DSX1 protein levels. Whole-mount immunofluorescence analysis revealed that the fluorescence intensity of appendages was significantly lower following RNAi treatment than the negative control group, and comparable with the blank control group, further confirming the decrease in Dsx1 expression after RNAi treatment. The number of offspring in all experimental groups was measured, and was significantly greater in the RNAi-treated group compared with the control group. These results provide a foundation for further work on the molecular basis of switching between the two modes of reproduction in cladocerans. The findings also further increase our understanding of the regulatory effects of Dsx1 in the differing sexes in these crustaceans.

Effect of HylocereusPolyrhizus Rind Extract Toward Interleukin-1β, Vascular Endothelial Growth Factor Expression, Endometriosis Implant Area

2017 ◽  
Vol 9 (08) ◽  
Author(s):  
YanuarEka P. ◽  
Hendy Hendarto ◽  
Widjiati .
Keyword(s):  
Vascular Endothelial Growth Factor ◽  
Growth Factor ◽  
Treatment Group ◽  
Negative Control Group ◽  
Negative Control ◽  
Control Group ◽  
Vascular Endothelial ◽  
Mice Model ◽  
Endothelial Growth Factor ◽  
Fruit Rind

Retrograde menstruation lead to I Kappa B Kinase (IKK) fosforilation in peritoneum macrophage and cause secretion of proinflammatory cytokine interleukin1β then stimulate endometriosis cell to produce Vascular Endothelial Growth Factor which lead to increasing of endometriosis lession seen as endometriosis implant area. Cytokine secretion was inhibited through prevention of NF-κB activation by dragon red fruit rind extract (Hylocereuspolyrhizus). The aim of this reserach is to know the effect of dragon red fuit rind extract with 0,25; 0,5; and 1 mg/g bodyweight dosage toward IL-1β, VEGF expression and implant area in endometriosis mice model. The design of this experiment was randomized post test only control group design.Endometrios mice model were made in 14 days and split into two group, positive control group and treatment group after two week negative control group and postive control group were given Na-CMC 0,5% solution consequetively, and treatment group were given dragon red fruit extract with different dosage. Signification number for IL-1β is p>0,05, signification number for VEGF is p>0,05, and implant area signification number is p>0,05. Administration of dragon red fruit rind extract can decrease IL-1β, VEGF, and implant area.

Employing Gamma Ray Irradiated Giardia lamblia as Trialed Vaccine in Experimental Animal

2019 ◽  
Vol 9 (02) ◽  
Author(s):  
Amal Kamil Abdul Sada ◽  
Amany Mohamed Al-Kaysi
Keyword(s):  
Giardia Lamblia ◽  
Gamma Ray ◽  
Age Groups ◽  
Active Phase ◽  
Study Groups ◽  
Negative Control ◽  
Control Group ◽  
High Dose ◽  
Histopathological Changes ◽  
Gamma Irradiated

This is an experimental trial to prepare a vaccine from gamma-irradiated Giardia lamblia which is evaluated in experimental animals. The study was conducted from December 2015 to April 2016. The field survey of the parasite was conducted from those patients attending the laboratories of the Alawi Children's Hospital in Rusafa and the Al-Yarmouk Teaching Hospital in Karkh, through which 1250 stool samples of different age groups were examined. Five groups of mice were used in the study; the first was injected with normal saline and considered as a negative control group, the second was injected with cystic form of non-irradiated Giardia lamblia and considered as a positive control group, whereas the other three groups were injected with gamma irradiated Giardia lamblia at three different doses 10, 15 and 25 rad respectively. Giardia lamblia was primarily cultivated in liver infusion agar for ten days to obtain the active phase. On the sixth day, the cystic phase was purified and standardized to be used in the infection of mice with or without the exposure of gamma rays. Mice showed high sensitivity to parasitic infestation, in the gamma non-irradiated and the irradiated with gamma 10 rad, and 15 rad irradiated groups which was 100%. The results expressed an excystation process of the depleted phases and the release of the feeder phases. The results of the three irradiated groups consisted of histopathological changes of the small, and the rectum by dissection after two weeks of infection, with intestine amputation lesions, as well as ulceration and inflammation of the inflammatory cells represented in small numbers of neutrophil, lymphocytes, and eosinophils. The presence of ulceration and fall of epithelial cells in the intestinal cavity has been shown, and different forms of the parasite have been observed. Mice which was injected with irradiated G lamblia at high dose (25 rad), not show and sensitivity to the challenge infection and no excystation of thy parasite had been done. After 2 wreaks, a comparison was achieved between all study groups in which no histopathological changes were noticed in the mice irradiated with dose of25 rad. After another two weeks, a challenge dose was given (un-attenuated G lamblia) and mice were dissected after another two weeks, no changes on the level of histopathology of intestinal tissue were noticed the results suggested that mice acquire an immunity against the parasite infection.

The Comparison of Ostecyte in the Pressure area and Tension area on Tooth Movement Because of Hyperbaric Oxygen Therapy

DENTA ◽  
2018 ◽  
Vol 12 (1) ◽  
pp. 34
Author(s):  
Arya Barahmanta ◽  
Muhammad Faizal Winaris ◽  
Pambudi Raharjo
Keyword(s):  
Hyperbaric Oxygen ◽  
Oxygen Therapy ◽  
Tooth Movement ◽  
Bone Remodelling ◽  
Orthodontic Tooth Movement ◽  
Negative Control Group ◽  
Positive Control ◽  
Negative Control ◽  
Control Group ◽  
Pressure Area

<p><strong><em>Background:</em></strong><em> Orthodontic tooth movement is a </em><em>interaction prosess</em><em> of resorption and deposition of bone remodeling. Orthodontic tooth movement by mechanical strength causes changes in alveolar bone. Osteocyte is an essential cell to respond bone remodelling. Hyperbaric Oxygen Therapy affects production of osteocyte because it can release Reactive Oxygen Species (ROS) and Nitrid Oxide (NO).  <strong>Purpose: </strong>To determine the difference number  of osteocyte in pressure and tension area during tooth movement by adjuvant of Hyperbaric Oxygen 2,4 ATA during 7 days starting on day 8 to day 14. <strong>Materials and Methods</strong>: This research used Completery Randomized Control Group Post Test Only Design. 36 cavia cobaya (male)  were divided into 3 groups randomly : the negative control groups, positive control group, and treatment group. Preparat staining used Hematoxylin Eosin (HE) and calculated on microscop 1000x with 20 field of view. Data analyses used one way ANOVA and LSD test then compared each area by using paired T test. <strong>Result:</strong> The data showed that the treatment group (P=10,67) tension area has the highest number of osteocyte than  negative control group (K-=3,67), positive control (K+=7,42). In the pressure area showed that negative control group (K-=5,00) has the highest  than positive control group (K+=3,83) and treatment (P=3,25). <strong>Conclusion: </strong>Therapy HBO 2,4 ATA 7 days starting on day 8 to day 14 is could increase osteocyte in the tissue to stimulate process of bone remodelling.</em></p><pre><strong> </strong></pre><p><strong><em>Keywords:</em></strong><em> Hyperbaric Oxygen, Tooth movement, Bone remodeling, </em><em>Osteocyte</em><em></em></p><p><em> </em></p><p><strong><em>Correspondence:</em></strong><em> </em><em>Arya Brahmanta</em><em>, Department of Orthodonty, Faculty of Dentistry, Hang Tuah University, Arif Rahman Hakim 150, Surabaya, Phone 031-5945864, Email:</em><em> </em><a href="mailto:[email protected]"><em>arya.brahmanta</em><em>@</em><em>hangtuah.ac.id</em></a></p>

Effects of Papaya Leaf Extract (Carica papaya L.) on Cellular Proliferation and Apoptosis in Cervical Cancer Mice Model

2019 ◽  
Vol 17 (5) ◽  
pp. 265-275
Author(s):  
Y. Peristiowati ◽  
Y. Puspitasari ◽  
Indasah
Keyword(s):  
Cervical Cancer ◽  
Cell Proliferation ◽  
Hela Cells ◽  
Leaf Extract ◽  
Caspase 3 ◽  
Methanol Extract ◽  
Negative Control ◽  
Proliferation Index ◽  
Control Group ◽  
P53 Expression

This study is aimed at analyzing the anticancer properties of papaya leaf extract, specifically the inhibition of cell proliferation and apoptotic induction through nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and p53 pathways. Twenty-five mice (Mus musculus), aged 2 months and weighing 20–30 g, was injected with 0.5 mg dexamethasone for 7 days. The mice were then injected intracutaneously with 1 ml of HeLa cells (8 × 106 HeLa cells/microliter). The mice were divided into five groups (5 each): negative control (P1) (5% CMC-Na, sodium carboxymethyl cellulose), treatment II (225 mg/kg BW (body weight) papaya leaves methanol extract), treatment III (450 mg/kg BW), treatment IV (750 mg/kg BW), and treatment PV (2 mg alcohol anticancer drug). Papaya leaf extract treatments were applied for 2 weeks. Then, the tumor tissue was isolated for hematoxylin and eosin staining. Immunohistochemical imaging was used to detect Ki-67, caspase-3, NF-κB, and p53 expression. Further analysis was undertaken using the ImmunoRatio software program. The results indicated that administration of papaya leaf methanol extract significantly increased the expression of NF-κB and p53 at a dose of 450 mg/kg BW. Our results also showed that the mice treated with 450 mg of papaya leaf extract per kg of BW (P3) had the largest increase of caspase-3 expression compared to the negative control group. Papaya leaf ethanol extract decreased the cancer cell proliferation index and increased apoptosis of cancer cells in animal models of cervical cancer; it may also work to increase NF-kB expression and expression of the p53 gene.

TOKSISITAS AKUT INFUSA KULIT ARI KACANG TANAH (Arachis hypogea L.) PADA MENCIT BALB/ C

2018 ◽  
Vol 15 (2) ◽  
pp. 62
Author(s):  
Risha Fillah Fithria ◽  
Ririn Lispita Wulandari ◽  
Devi Nisa Hidayati ◽  
Lilis Rejeki
Keyword(s):  
Single Dose ◽  
Color Change ◽  
Negative Control ◽  
Control Group ◽  
Hair Color ◽  
Peanut Shell ◽  
Control Group Design ◽  
Safety Standards ◽  
Arachis Hypogea ◽  
Passive Behavior

ABSTRACTPeanut shell (PS) infusion has been shown to be antithrombocytopenia, but there has been no research on safety standards. This study aims to identify the symptoms of toxic effects, the potency of toxicity and histopathology of liver male Balb/C mice after a single dose of PS infusion. This research uses randomized matched posttest only control group design. Twenty five mice were divided into 5 orally dosage groups, ie, PS infusion with a dose of 0,026; 0.052; 0.104; 0.208 g/20gBW; and negative control of CMC Na 0.5%. The observation period is for 14 days. The results showed that single dose of PS infusion had a pseudo LD50 value ie > 0.208g/20gBW which was practically non toxic. Symptoms to watch out for the BW infusion were passive behavior, bradycnea, hair color change, hair loss, and weight loss at doses of 3 and 4. It is unclear whether liver damage ie inflammation, necrosis, and albuminous degeneration caused by PS infusion or other causes.keywords: acute toxicity, infusion, peanut shell

Antiurolithiatic effect of Cymbopogon Proximus, Alhagi Maurorum, on Sulfadimidine induced urolithiasis in male New Zealand rabbits

2019 ◽  
Vol 20 (1) ◽  
pp. 12-18
Author(s):  
Sameh El-Nabtity
Keyword(s):  
New Zealand ◽  
Intramuscular Injection ◽  
Negative Control Group ◽  
Negative Control ◽  
Control Group ◽  
Aqueous Extracts ◽  
Blood And Urine Samples ◽  
Group 2 ◽  
New Zealand Rabbits ◽  
Group 1

The present study aimed to investigate the prophylactic effect of Cymbopogon proximus and Alhagi maurorum on Sulfadimidine induced urolithiasis in rabbits . Thirty New Zealand male rabbits were allocated into six equal groups (each of five): Group (1) was used as a negative control. Group(2) were administered sulfadimidine (200mg/kg) by intramuscular injection.Groups(3) and (4) were administered sulfadimidine(200mg/kg) by intramuscular injection and 330mg/kg of Cymbopogon proximus alcoholic and aqueous extracts respectively orally.Groups(5) and (6) were administered sulfadimidine(200mg/kg) by intramuscular injection and 400mg/kg of Alhagi maurorum alcoholic and aqueous extracts respectively orally. The period of experiment was 10 days. Blood and urine samples were collected from rabbits on the 10th day. The results recorded a significant decrease in serum creatinine, urea, uric acid and crystalluria in Cymbopogon proximus and Alhagi maurorum groups compared to sulfadimidine treated group.We conclude that Cymbopogon proximus and Alhagi maurorum have a nephroprotective and antiurolithiatic effects against sulfadimidine induced crystalluria.

PENGARUH PEMBERIAN FRAKSI ETILASETAT KULIT UBI JALAR UNGU TERHADAP KADAR MALONDIALDEHID (MDA) SERUM MENCIT PUTIH JANTAN HIPERGLIKEMIA

2018 ◽  
Vol 8 (2) ◽  
pp. 144
Author(s):  
Ria Afrianti
Keyword(s):  
Blood Glucose ◽  
Statistical Analysis ◽  
Sweet Potato ◽  
Ethyl Acetate Fraction ◽  
Serum Levels ◽  
Negative Control ◽  
Control Group ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Purple Sweet Potato

This study aims to determine the effect giving of ethylacetate fraction of leather  purple sweet potato (Ipomoea batatas (L.) Lam, on levels of malondialdehyde (MDA) serum in mice hyperglicemia were induced with streptozocin dose of 50 mg/kgBW. Mice were divided into 5 groups, each group consisting of 3 tails, group I is a negative control, group II is a positive control, group III,IV and V is given ethylacetate fraction a dose of 100 mg/kgBW, 300 mg/kgBW, and 600 mg/kgBW. Ethyl Acetate Fraction leather purple sweet potato given orally for 15 days after the animal is declared hyperglicemia and measurement of blood glucose levels on 5, 10, and 15 day after giving test preparation in animal experiments. On the 16 day throughout the mice were taken serum levels measured malondialdehid. The statistical analysis results showed that giving of ethyl acetate fraction of leather purple sweet potato at a dose of 100 mg/kgBW, 300 mg/kgBW, and 600 mg/kgBW can lower blood glucose levels in mice hyperglycemia significantly (p<0.05). Malondialdehid levels on average in each group is 1.35 nmol/ml, 3.00 nmol/ml, 2.72 nmol/ml, 2.20 nmol/ml and 2.61 nmol/ml, the results of statistical analysis showed a decrease in melondialdehid serum levels were significantly (p<0.05), where a dose of 300 mg/kgBW is an effective dose for lowering blood glucose levels followed by decreased levels of malondialdehid which give effect approaching negative control.

Sign in / Sign up

Export Citation Format

Share Document