scholarly journals Exploration of entomopathogenic fungi as potential biocontrol of corn earworm (Helicoverpa armigera (Hübner)

2021 ◽  
Vol 911 (1) ◽  
pp. 012064
Author(s):  
Amelia Sebayang ◽  
Andi Tenrirawe ◽  
Hishar Mirsam
Keyword(s):  
Entomopathogenic Fungi ◽  
Control Method ◽  
Polymorphic Information Content ◽  
Dna Amplification ◽  
Corn Earworm ◽  
Morphological Identification ◽  
Corn Production ◽  
North Sulawesi ◽  
Potential Risks ◽  
Different Color

Abstract In Indonesia, H. armigera caused loss in corn production until 40% and almost attack all region. Therefore, this pest is a concern especially in corn plantations in Indonesia. In the development of H. armigera pest control, the use of entomopathogenic fungi increases after the potential risks of using chemical pesticides in various aspects. Biological control using entomopathogen agents is an alternative control method that has been studied widely and considerably more effective and environmentally friendly. This study aims explore entomopathogen that attack H. armigera which will later be formulated and projected as candidates for biopesticides controlling H. armigera. This research sited in East Java, South Sulawesi, and North Sulawesi in 2011. This research was divided into several stages within a year which were carried out including surveys and samples collection, isolation, characterization, morphological identification and molecular identification (genotyping phylogenetic tree). The research found several pathogens from several location such as Rhizopus sp., Beauveria bassiana, Fusarium sp., Aspergilus flavus, and Gliocladium sp. The character of each Entomopathogenic fungus showed that every isolate has different color and shapes. Based on the results of DNA amplification from eleven fungal isolates using BOX primers, various fragments were produced with sizes ranging from 225 to 1250 bp. The results also showed that all the isolates tested had polymorphic bands with a polymorphic information Content (PIC) value of 0.84. This indicates that these isolates have a low level of polymorphism.

scholarly journals IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA

2020 ◽  
Vol 7 (2) ◽  
pp. 57
Author(s):  
Ni Putu Merthaningsih ◽  
I Putu Sudiarta ◽  
Gusti Ngurah Alit Susanta Wirya
Keyword(s):  
Entomopathogenic Fungi ◽  
Natural Enemies ◽  
Evolutionary Genetics ◽  
Morphological Identification ◽  
Chemical Insecticide ◽  
Negative Effect ◽  
Citrus Production ◽  
Reverse Primer ◽  
Environmentally Friendly Method ◽  
Forward Primer

One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target  of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is  Paraleyrodes minei.

scholarly journals Keragaman Fenotipe dan Genetik Kumbang Brontispa longissima (Coleoptera: Chrysomelidae) pada Tanaman Kelapa; The Genetic and Phenotypic Diversities of Brontispa longissima Beetle (Coleoptera: Chrysomelidae) on Coconut Palms

Buletin Palma ◽  
2018 ◽  
Vol 18 (2) ◽  
pp. 83
Author(s):  
Jelfina C. Alouw ◽  
Ismail Maskromo ◽  
Fadjry Djufry
Keyword(s):  
Rapd Markers ◽  
Rapd Marker ◽  
Leaf Damage ◽  
Yield Losses ◽  
North Sulawesi ◽  
South Sulawesi ◽  
Two Samples ◽  
West Papua ◽  
Papua Barat ◽  
Different Color

<p align="center"><strong>ABSTRAK</strong></p><p><em>Brontispa longissima </em>merupakan salah satu hama utama kelapa yang dapat menyebabkan kerusakan daun dan kehilangan hasil kelapa secara ekonomi. Terdapat variasi warna dan pola pewarnaan <em>elytra</em> <em>B. longissima</em> yang tersebar di Indonesia. Tujuan penelitian adalah untuk menganalisis keragaman fenotipe dan genetik hama <em>Brontispa longissima</em> yang berasal dari beberapa daerah dengan menggunakan marka RAPD. Analisis keragaman genetik berdasarkan marka RAPD dilakukan terhadap hama <em>B. longissima</em> yang dikoleksi dari Sulawesi Utara (Sulut), Sulawesi Selatan (Sulsel), Ambon/Seram, dan Papua Barat. Penelitian dilaksanakan di Laboratorium Terpadu Hama dan Penyakit Balai Penelitian Tanaman Palma (Balit Palma), dan Laboratorium Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian (BB Biogen), dari Bulan Maret sampai dengan November 2016. Berdasarkan analisis RAPD menggunakan 3 primer pada enam sampel <em>B. longissima </em>menunjukkan sampel mengelompok menjadi dua kelompok besar yaitu kelompok I terdiri atas sampel Papua Barat dan Sulsel 2 dan kelompok II  terdiri dari sampel  Ambon/Seram, Sulut 1, Sulut 2 dan Sulsel 1  dengan tingkat kemiripan sekitar 50%. Pada kelompok I, sampel Papua Barat dan Sulsel 2 mempunyai kemiripan sekitar 75%. Kemiripan tertinggi      (&gt; 80 %) tampak antara sampel Sulut 1 dan Sulut 2 yang memiliki warna dan pola warna <em>elytra</em> yang berbeda. Primer OPA 01 dapat digunakan untuk membedakan antar sampel atau keragaman populasi sehingga dapat diaplikasikan sebagai alat deteksi yang cepat dan akurat.   </p><p align="center"><strong> </strong></p><p align="center"><strong>ABSTRACT</strong></p><em>Brontispa longissima </em>is one of the main pests of coconut causing leaf damage and yield losses. Variation of color and pattern of the elytra was found among population of <em>B. longissima</em> distributed in Indonesia. The objective of the study was to analyze the phenotypic and genetic diversities of <em>Brontispa longissima</em> pests from several regions using RAPD markers. RAPD marker based diversities analysis was carried out to evaluate genetic and phenotipic relationships among population of <em>B. longissima</em> collected from North Sulawesi (Sulut), South Sulawesi (Sulsel), Ambon/Seram, and West Papua. Laboratory expriments were carried out at the Integrated Pest and Disease Laboratory of The Indonesian Palm Crops Research Institute (IPCRI) and the Laboratory of The Indonesian Center For Agricultural Biotechnology And Genetic Resources Research and Development (ICABOG RAD) from March to November 2016.  Three of the twenty primers selected, have grouped the samples into two distinct clusters.  Cluster analysis indicated 75% similarities between West Papua (P) populations and collections from South Sulawesi 2, and 50% similarities among samples from Ambon/Seram, North Sulawesi 1 and 2, and South Sulawesi 1. The highest similarity of more than 80% was found on two samples from North Sulawesi having different color and pattern of elytra. Primer OPA-01 showed highest polymorphism percentage.

scholarly journals Evaluation of Clonal Uniformity in Six Superior Cacao Clones Based on SSR Marker

2018 ◽  
Vol 5 (3) ◽  
pp. 135
Author(s):  
Indah Sulistiyorini ◽  
Rubiyo Rubiyo ◽  
Sudarsono Sudarsono
Keyword(s):  
Ssr Markers ◽  
Polymorphic Information Content ◽  
Germplasm Conservation ◽  
Plant Molecular Biology ◽  
Dna Amplification ◽  
Genetic Uniformity ◽  
Two Samples ◽  
Ssr Loci ◽  
Variant Alleles ◽  
Biology Laboratory

<p><em>Propagation of cacao plants is generally carried out vegetatively. Therefore, plants that are clonally propagated should be genetically uniform. Genetic uniformity in cacao clones is also very important information for germplasm conservation and in obtaining pure parental crosses. Evaluation of genetic uniformity can be seen through analysis using SSR markers. This study aimed to determine the genetic uniformity in six cacao clones using SSR markers. This experiment was conducted at IIBCRI Integrated Laboratory in Sukabumi and Plant Molecular Biology Laboratory, IPB Bogor, from September 2015 to December 2016.  Six cacao clones used (TSH 858, TSH 908, ICS 13, PA 300, GC 7 and UIT) are from Kalitelepak experimental station of  PTPN XII, Genteng District, Banyuwangi, East Java.  Ten samples were taken randomly to represent cacao clones. DNA amplification was carried out using 12 SSR markers. The result showed that 12 SSR markers generated 45 alleles with the number of alleles per locus was 3-4 alleles. The polymorphic information content (PIC) ranges from 0.37</em>–<em>0.67, which are identied as very informative molecular analysis </em><em>in identifying the genetical uniformity of the evaluated cacao population. Six SSR loci generated variant alleles within both the TSH 858 and UIT clones, indicating there are off-type plants in these two samples. Clonal uniformity were detected for samples of the GC 7, ICS 13, PA 300 and TSH 908 clones. On the other hand, 8.33% of evaluated samples within the TSH 858 and UIT clones were off-type plants.</em></p>

scholarly journals Seeding development potential and prospects of NASA 29 hybrid corn in North Sulawesi Province

2021 ◽  
Vol 911 (1) ◽  
pp. 012089
Author(s):  
Supratman Sirih ◽  
Jefny B. Markus Rawung ◽  
Rita Indrasti ◽  
Ronald T. P. Hutapea ◽  
Yusuf
Keyword(s):  
Production Data ◽  
Rating Score ◽  
Corn Production ◽  
Maize Seeds ◽  
North Sulawesi ◽  
Hybrid Seeds ◽  
The Government ◽  
Hybrid Maize ◽  
Government Production ◽  
Very High

Abstract North Sulawesi is one of the areas with great potential in supporting the production and productivity of hybrid maize seeds. The land available for the cultivation of hybrid maize seeds is very wide, the requirements for agro-climatic are simple, the technology is readily available, so that the prospect of profits for the cultivator is quite large. Most of the maize farmers in North Sulawesi tend to use hybrid seeds. This is because the yield obtained is very high, however, the availability of hybrid seeds is very limited, even if available, the price is quite expensive. Farmers are currently still dependent on seed assistance from the Government. Production of seeds through breeder farmers as a solution in order to increase corn production. NASA 29 variety is a new superior variety derived from male parents G102612 and Mal 03 as female parents. The results of the interview showed that 86% of the 25 respondents of maize farmers gave an average rating score of 3.8. This shows that they really like the characteristics of the plant. The production data for NASA 29 seed candidates is 3.6 tons / ha. These results indicate that the prospect of hybrid maize seeding business is profitable for breeder farmers.

scholarly journals An Overview on Biopesticidal and Virulent nature with Pathogenic aspects of Entomopathogenic fungi on Insects

2016 ◽  
Vol 4 (01) ◽  
pp. 34-38
Author(s):  
Arjun Shukla
Keyword(s):  
Pest Control ◽  
Entomopathogenic Fungi ◽  
Control Method ◽  
Insect Pest ◽  
Control Program ◽  
Disease Symptoms ◽  
Host Insect ◽  
Insect Order ◽  
Environmental Friendly ◽  
Integrated Pest Control

Entomopathogenic fungi are very heterogeneous group used for management of insect pest. From last 2 decade in the search for new avenues in biological control, the importance of entomopathogens has been highlighted as an environmental friendly pest control method came in existence which is sustainable solution towards integrated pest control program. Fungi, which induce disease symptoms in insects, include fungi from quick killers to absolute parasites that provide disease symptoms in the host. Insect order and families are reviewed which were affected severely by entomopathogenic fungi.

Identifikasi Tumbuhan Paku Air (Azolla sp.) Secara Morfologi dan Molekuler dengan Menggunakan Gen rbcL (Identification of Water Ferns (Azolla sp.) Based on Morphologycal Traits and Molecular Marker Using rbcL Gene)

2018 ◽  
Vol 8 (2) ◽  
pp. 38
Author(s):  
Wianita Mantang ◽  
Feky R. Mantiri ◽  
Beivy J. Kolondam
Keyword(s):  
Genetic Distance ◽  
Morphological Characters ◽  
Morphological Identification ◽  
Rbcl Gene ◽  
Distance Analysis ◽  
Central Java ◽  
North Sulawesi ◽  
Close Relationship ◽  
Water Ferns ◽  
Genetic Distance Analysis

Abstrak Azolla merupakan salah satu tumbuhan paku air yang memiliki banyak manfaat, namun belum banyak dikenal dan sering dianggap sebagai tumbuhan gulma. Pengidentifikasian akan keberadaan jenis-jenis tumbuhan paku air (Azolla sp.) penting untuk dilakukan guna mendukung upaya pengembangan, pembudidayaan dan eksplorasi tumbuhan Azolla sp. Penelitian ini bertujuan untuk mengidentifikasi spesies tumbuhan paku air (Azolla sp.) secara morfologi dan molekuler dengan menggunakan gen rbcL. Hasil penelitian menunjukkan bahwa berdasarkan karakter morfologi sampel tumbuhan Azolla sp. asal Tondano Sulawesi Utara menunjukkan kemiripan dengan spesies A. pinnata dan Azolla asal Magelang Jawa Tengah menunjukkan kemiripan dengan spesies A. microphylla. Identifikasi menggunakan sekuens gen rbcL menunjukkan bahwa sekuens sampel tumbuhan Azolla asal Tondano (WM1) memiliki tingkat kemiripan 100% dengan A. pinnata dan Azolla asal Magelang (WM2) memiliki tingkat kemiripan 100% dengan A. microphylla yang terdapat dalam GenBank. Analisis jarak genetik menunjukkan kedua sampel WM1 dan WM2 memiliki hubungan kekerabatan yang cukup dekat dengan nilai jarak genetik 0,060.Kata kunci: Azolla sp., identifikasi morfologi, identifikasi molekuler, gen rbcL Abstract Azolla is one of the water ferns that has many benefits, but it is not yet widely known and is often regarded as a weed plant. Identification of water ferns (Azolla sp.) is important to be carried out to support the development, cultivation, and exploration of Azolla sp. This study aimed to identify species of aquatic plants (Azolla sp.) morphologically and molecularly using the gene rbcL. The results demonstrated that based on the morphological characters, the Azolla sp. from Tondano, North Sulawesi, showed similarity with species A. pinnata and Azolla from Magelang, Central Java, showed similarity to species A. microphylla. Identification using rbcL gene sequences showed that the sample sequence of plants Azolla from Tondano (WM1) had a 100% similarity level with A. pinnata and Azolla from Magelang (WM2) had a 100% similarity level with A. microphylla available in GenBank. Genetic distance analysis showed that both WM1 and WM2 samples had a close relationship with the genetic distance value of 0.060.Key words: Azolla sp., morphological identification, molecular identification, rbcL gene

THE RESULT OF PLANT PATHOGENIC FUSARIUM SPP ISOLATED FROM CONIFEROUS FOREST IN NEAR ULAANBATAAR CITY

2015 ◽  
Vol 13 (2) ◽  
pp. 101-104
Author(s):  
D Nasanjargal ◽  
M Otgonzaya ◽  
R Chinzorig ◽  
M Byambasuren
Keyword(s):  
Bacillus Subtilis ◽  
Entomopathogenic Fungi ◽  
Pure Culture ◽  
Control Method ◽  
Fungal Growth ◽  
Fusarium Spp ◽  
Disease Symptoms ◽  
Mycelia Growth ◽  
Fungus Growth ◽  
Made In

Fusarium type of fungi forms whitish or bright color and grows really fast. Fusarium subglutinans f. sp. pini (F. circinatum Nirenbery & O’Donnell), F. Oxysporum f. sp. Psidii and F. solani are widely distributed plant entomopathogenic fungi. This fungus usually gives a signs of yellowing, drying and shedding when causing disease.Main aim of our study is to identify Fusarium spp fungi based on disease symptoms such as yellowing, drying and shedding of the needles then define isolated pure culture of fungi and formulate control method. [4,6,7]In this study atotal of sixty-nine samples including larch, pine and spruce were collected from 8 locations out of 127 pieces collected from 13 locations are used. According to standard methodology, when isolating mixed and pure culture samples were placed on wet Petri dish in incubator at 26°C for 7 days until the fungus growth appearedalso average mycelia growth and conidia have observed.This Fusariumspecie typically gives whitish tinged grayish-violent color in colony center on PDA. Observing culture mycelia growth and conidia, genus name has identified using “Identification of Mitosporic Fungi” by Dr. Katsuhiko Ando. When formulating control method against fungi, bioproduct of Bacillus subtilis 26D strain, made in Russian as well as plant originated bioproduct called 1.5 % Matrine & Osthole Asmade in China have been experimented against entomopathogenic fungi Fusarium sppareused. Based on the study results Fusarium type of fungi is detected from samples taken from Bogdiin am, Jigjid and Taivan mountain. Hence bioproduct of Bacillus subtilis 26D strain inhibited fungal growth whereas can be possible biocontrol for Fusarium spp whereas plant originated bioproduct 1.5% Matrine & Osthole AS made in P.R.C cannot inhibit the growth of this fungi.Forest morbidity is not well researched in Mongolia. Based on our research forest regions near Ulaanbaatar city have higher morbidity rate. Disease symptoms of conifers have shown yellowing, drying and even shedding of the needles.A total of sixty-nine samples including larch, pine and spruce were collected from 8 locations near Ulaanbaatar city. Samples were placed on wet plates in incubator at 26°C for 7 days until the fungus growth appeared. Fresh fungal growth from the plated samples then transferred onto PDA. Fusarium species typically have average mycelia growth, aerial mycelium and gives whitish tinged grayish-violent color in colony center on PDA.Mongolian Journal of Agricultural Sciences Vol.13(2) 2014: 101-104

scholarly journals DNA recovery from microhymenoptera using six non-destructive methodologies with considerations for subsequent preparation of museum slides

Genome ◽  
2017 ◽  
Vol 60 (1) ◽  
pp. 85-91 ◽  
Author(s):  
Adriana J. Guzmán-Larralde ◽  
Alba P. Suaste-Dzul ◽  
Adrien Gallou ◽  
Kenzy I. Peña-Carrillo
Keyword(s):  
Dna Extraction ◽  
Mitochondrial Gene ◽  
Dna Amplification ◽  
Morphological Identification ◽  
Direct Pcr ◽  
Dna Recovery ◽  
Require Time ◽  
Gene Coi ◽  
Permanent Slide ◽  
Non Destructive

Because of the tiny size of microhymenoptera, successful morphological identification typically requires specific mounting protocols that require time, skills, and experience. Molecular taxonomic identification is an alternative, but many DNA extraction protocols call for maceration of the whole specimen, which is not compatible with preserving museum vouchers. Thus, non-destructive DNA isolation methods are attractive alternatives for obtaining DNA without damaging sample individuals. However, their performance needs to be assessed in microhymenopterans. We evaluated six non-destructive methods: (A) DNeasy® Blood & Tissue Kit; (B) DNeasy® Blood & Tissue Kit, modified; (C) Protocol with CaCl2 buffer; (D) Protocol with CaCl2 buffer, modified; (E) HotSHOT; and (F) Direct PCR. The performance of each DNA extraction method was tested across several microhymenopteran species by attempting to amplify the mitochondrial gene COI from insect specimens of varying ages: 1 day, 4 months, 3 years, 12 years, and 23 years. Methods B and D allowed COI amplification in all insects, while methods A, C, and E were successful in DNA amplification from insects up to 12 years old. Method F, the fastest, was useful in insects up to 4 months old. Finally, we adapted permanent slide preparation in Canada balsam for every technique. The results reported allow for combining morphological and molecular methodologies for taxonomic studies.

scholarly journals The isolation and identification of pathogenic fungi from Tessaratoma papillosa Drury (Hemiptera: Tessaratomidae)

PeerJ ◽  
2017 ◽  
Vol 5 ◽  
pp. e3888 ◽  
Author(s):  
Xiang Meng ◽  
Junjie Hu ◽  
Gecheng Ouyang
Keyword(s):  
Entomopathogenic Fungi ◽  
Southern China ◽  
Biological Control Agent ◽  
Pathogenic Fungi ◽  
Control Agent ◽  
Morphological Identification ◽  
Pest Species ◽  
Stink Bug ◽  
Isolation And Identification ◽  
Highly Virulent

Background Litchi stink-bug, Tessaratoma papillosa Drury (Hemiptera: Tessaratomidae), is one of the most widespread and destructive pest species on Litchi chinensis Sonn and Dimocarpus longan Lour in Southern China. Inappropriate use of chemical pesticides has resulted in serious environmental problems and food pollution. Generating an improved Integrated Pest Management (IPM) strategy for litchi stink-bug in orchard farming requires development of an effective biological control agent. Entomopathogenic fungi are regarded as a vital ecological factor in the suppression of pest populations under field conditions. With few effective fungi and pathogenic strains available to control litchi stink-bug, exploration of natural resources for promising entomopathogenic fungi is warranted. Methods & Results In this study, two pathogenic fungi were isolated from cadavers of adult T. papillosa. They were identified as Paecilomyces lilacinus and Beauveria bassiana by morphological identification and rDNA-ITS homogeneous analysis. Infection of T. papillosa with B. bassiana and P. lilacinus occurred initially from the antennae, metameres, and inter-segmental membranes. Biological tests showed that the two entomopathogenic fungi induced high mortality in 2nd and 5th instar nymphs of T. papillosa. B. bassiana was highly virulent on 2nd instar nymphs of T. papillosa, with values for cadaver rate, LC50 and LT50 of 88.89%, 1.92 × 107 conidia/mL and 4.34 days respectively. Discussion This study provides two valuable entomopathogenic fungi from T. papillosa. This finding suggests that the highly virulent P. lilacinus and B. bassiana play an important role in the biocontrol of T. papillosa in China. These pathogenic fungi had no pollution or residue risk, and could provide an alternative option for IPM of litchi stink-bug.

Sign in / Sign up

Export Citation Format

Share Document