scholarly journals MOS1 Osmosensor of Metarhizium anisopliae Is Required for Adaptation to Insect Host Hemolymph

2007 ◽  
Vol 7 (2) ◽  
pp. 302-309 ◽  
Author(s):  
Chengshu Wang ◽  
Zhibing Duan ◽  
Raymond J. St. Leger
Keyword(s):  
Osmotic Pressure ◽  
Stress Responses ◽  
Metarhizium Anisopliae ◽  
Turgor Pressure ◽  
Adaptor Proteins ◽  
Reverse Transcription Pcr ◽  
Oxidative Stresses ◽  
Hyphal Bodies ◽  
Increased Sensitivity ◽  
Src Homology

ABSTRACT Entomopathogenic fungi such as Metarhizium anisopliae infect insects by direct penetration of the cuticle, after which the fungus adapts to the high osmotic pressure of the hemolymph and multiplies. Here we characterize the M. anisopliae Mos1 gene and demonstrate that it encodes the osmosensor required for this process. MOS1 contains transmembrane regions and a C-terminal Src homology 3 domain similar to those of yeast osmotic adaptor proteins, and homologs of MOS1 are widely distributed in the fungal kingdom. Reverse transcription-PCR demonstrated that Mos1 is up-regulated in insect hemolymph as well as artificial media with high osmotic pressure. Transformants containing an antisense vector directed to the Mos1 mRNA depleted transcript levels by 80%. This produced selective alterations in regulation of genes involved in hyphal body formation, cell membrane stiffness, and generation of intracellular turgor pressure, suggesting that these processes are mediated by MOS1. Consistent with a role in stress responses, transcript depletion of Mos1 increased sensitivity to osmotic and oxidative stresses and to compounds that interfere with cell wall biosynthesis. It also disrupted developmental processes, including formation of appressoria and hyphal bodies. Insect bioassays confirmed that Mos1 knockdown significantly reduces virulence. Overall, our data show that M. anisopliae MOS1 mediates cellular responses to high osmotic pressure and subsequent adaptations to colonize host hemolymph.

scholarly journals Yeast osmosensor Sln1 and plant cytokinin receptor Cre1 respond to changes in turgor pressure

2003 ◽  
Vol 161 (6) ◽  
pp. 1035-1040 ◽  
Author(s):  
Vladimír Reiser ◽  
Desmond C. Raitt ◽  
Haruo Saito
Keyword(s):  
Cell Wall ◽  
Stress Responses ◽  
Histidine Kinase ◽  
Turgor Pressure ◽  
Hyperosmotic Stress ◽  
Cytokinin Receptor ◽  
High Osmolarity ◽  
High Osmolarity Glycerol ◽  
High Osmolarity Glycerol Pathway ◽  
Cytokinin Response

Very little is known about how cellular osmosensors monitor changes in osmolarity of the environment. Here, we report that in yeast, Sln1 osmosensor histidine kinase monitors changes in turgor pressures. Reductions in turgor caused by either hyperosmotic stress, nystatin, or removal of cell wall activate MAPK Hog1 specifically through the SLN1 branch, but not through the SHO1 branch of the high osmolarity glycerol pathway. The integrity of the periplasmic region of Sln1 was essential for its sensor function. We found that activity of the plant histidine kinase cytokinin response 1 (Cre1) is also regulated by changes in turgor pressure, in a manner identical to that of Sln1, in the presence of cytokinin. We propose that Sln1 and Cre1 are turgor sensors, and that similar turgor-sensing mechanisms might regulate hyperosmotic stress responses both in yeast and plants.

Turgor-Volume Regulation and Cellular Water Relations of Nicotiana tabacum Roots Grown in High Salinities

1989 ◽  
Vol 16 (6) ◽  
pp. 517 ◽  
Author(s):  
SD Tyerman ◽  
P Oats ◽  
J Gibbs ◽  
M Dracup ◽  
H Greenway
Keyword(s):  
Nicotiana Tabacum ◽  
Osmotic Pressure ◽  
Water Relations ◽  
Volume Regulation ◽  
Turgor Pressure ◽  
Root Hairs ◽  
Solution Culture ◽  
Pressure Probe ◽  
Initial Increase ◽  
Solute Permeability

Nicotiana tabacum plants were grown in solution culture with salinity treatments of 1, 100 and 200 mol m-3 [NaCl], in Hoagland solution. After several weeks, solute concentrations and osmotic pressure of cell sap from the roots were measured. Increases in cellular [Na+] and [Cl-] and a smaller reduction in [K+] accounted for the difference in sap osmotic pressure between the 200 mol m-3 and 1 mol m-3 treatments. Turgor pressure (P) of fully expanded cortex cells measured with the pressure probe were 0.48 MPa in 1 mol m-3, 0.24 MPa in 100 mol m-3, 0.20 MPa in 200 mol m-3, and these values agreed with those calculated by difference between internal and external osmotic pressure. Low values of volumetric elastic modulus (ε), ranging from 1.2 MPa to 3.0 MPa at P = 0.42 MPa were obtained, which accounted for long equilibration times to changes in water potential. There was no effect of high salinities on ε after accounting for the fact that ε was a function of P and neither was there an effect on hydraulic conductivity (Lp), which ranged between 1.9 × 10-8 and 24.1 × 10-8 m s-1 Mpa-1. At 200 mol m-3 [NaCl]o, and to a lesser degree at 100 mol m-3 [NaCl]o, root hairs became deformed to resemble spherical bladders (mean diameter = 88 �m) which displayed similar P and water relations to other epidermal cells and cortex cells. In other experiments the response to a sudden reduction in [NaCl], from 200 to 1 mol m-3 was studied. P of cortex cells first rapidly increased from about 0.15 MPa to 0.53 MPa and then slowly declined with a half time of about 35 min to a new steady state of 0.3 MPa. This level was maintained in intact roots for at least 48 h. The rate of the initial increase in P is limited by water flow into the cells while the slow decline is limited by solute efflux from the cells with water following osmotically. The efflux was mainly in response to reduced external osmotic pressure rather than [NaCl]o. Efflux of Na+, K+ and Cl- accounted for the decrease in internal osmotic pressure but it is possible that the membrane also became more permeable to sugars. With the exception of bladder hairs, the overall integrity of the cell membrane was maintained since Lp did not increase and P declined smoothly to the new level with no evidence of rupture and resealing of the membrane. It is argued that the loss of solutes after the step down in external osmotic pressure consists of turgor or volume regulation in which solute permeability increases steeply as turgor or volume goes above a threshold.

A comparison of systematic errors between the Richards and Hammel methods of measuring tissue – water relations parameters

1978 ◽  
Vol 56 (17) ◽  
pp. 2153-2161 ◽  
Author(s):  
M. T. Tyree ◽  
M. E. MacGregor ◽  
A. Petrov ◽  
M. I. Upenieks
Keyword(s):  
Cell Wall ◽  
Osmotic Pressure ◽  
Water Relations ◽  
Turgor Pressure ◽  
Systematic Errors ◽  
Tissue Water ◽  
Cell Wall Elasticity ◽  
Pressure Bomb ◽  
Bomb Method

The pressure bomb is being used to a much greater extent to measure some tissue – water relations parameters such as osmotic pressure, turgor pressure, and cell wall elasticity. Recently, Richards has developed a faster pressure-bomb method of obtaining these and other parameters than the method used by Hammel and modified by us. In this paper, we compare the two methods and conclude that Richards’ method should not be used when accuracy is deemed important. The Richards method usually overestimates osmotic pressure by 0.2 MPa (= 2 bars) and sometimes by 0.8 MPa (= 8 bars).

scholarly journals Comparative Proteomic Analysis of Tolerance and Adaptation of Ethanologenic Saccharomyces cerevisiae to Furfural, a Lignocellulosic Inhibitory Compound

2009 ◽  
Vol 75 (11) ◽  
pp. 3765-3776 ◽  
Author(s):  
Feng-Ming Lin ◽  
Bin Qiao ◽  
Ying-Jin Yuan
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Stress Responses ◽  
Tricarboxylic Acid Cycle ◽  
Expression Profiles ◽  
Proteome Analysis ◽  
Redox Balance ◽  
Central Carbon Metabolism ◽  
Alcohol Dehydrogenases ◽  
Reverse Transcription Pcr ◽  
The Unfolded Protein Response

ABSTRACT The molecular mechanism involved in tolerance and adaptation of ethanologenic Saccharomyces cerevisiae to inhibitors (such as furfural, acetic acid, and phenol) represented in lignocellulosic hydrolysate is still unclear. Here, 18O-labeling-aided shotgun comparative proteome analysis was applied to study the global protein expression profiles of S. cerevisiae under conditions of treatment of furfural compared with furfural-free fermentation profiles. Proteins involved in glucose fermentation and/or the tricarboxylic acid cycle were upregulated in cells treated with furfural compared with the control cells, while proteins involved in glycerol biosynthesis were downregulated. Differential levels of expression of alcohol dehydrogenases were observed. On the other hand, the levels of NADH, NAD+, and NADH/NAD+ were reduced whereas the levels of ATP and ADP were increased. These observations indicate that central carbon metabolism, levels of alcohol dehydrogenases, and the redox balance may be related to tolerance of ethanologenic yeast for and adaptation to furfural. Furthermore, proteins involved in stress response, including the unfolded protein response, oxidative stress, osmotic and salt stress, DNA damage and nutrient starvation, were differentially expressed, a finding that was validated by quantitative real-time reverse transcription-PCR to further confirm that the general stress responses are essential for cellular defense against furfural. These insights into the response of yeast to the presence of furfural will benefit the design and development of inhibitor-tolerant ethanologenic yeast by metabolic engineering or synthetic biology.

scholarly journals Development of Binding Assays for the SH2 Domain of Grb7 and Grb2 Using Fluorescence Polarization

2008 ◽  
Vol 13 (2) ◽  
pp. 112-119 ◽  
Author(s):  
Jean-Philippe Luzy ◽  
Huixiong Chen ◽  
Brunilde Gril ◽  
Wang-Qing Liu ◽  
Michel Vidal ◽  
...  
Keyword(s):  
Fluorescence Polarization ◽  
Adaptor Proteins ◽  
Specific Protein ◽  
Sh2 Domain ◽  
Enzyme Linked Immunosorbent Assay ◽  
Binding Assays ◽  
Protein Targets ◽  
Src Homology 2 ◽  
Src Homology ◽  
Micromolar Range

Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY1139. Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(αMe)pTyr-Asn-NH2) that exhibits the most potent affinity for the Grb7 SH2 domain described to date. ( Journal of Biomolecular Screening 2008:112-119)

scholarly journals Crystal Structures and Thermodynamic Analysis Reveal Distinct Mechanisms of CD28 Phosphopeptide Binding to the Src Homology 2 (SH2) Domains of Three Adaptor Proteins

2016 ◽  
Vol 292 (3) ◽  
pp. 1052-1060 ◽  
Author(s):  
Satomi Inaba ◽  
Nobutaka Numoto ◽  
Shuhei Ogawa ◽  
Hisayuki Morii ◽  
Teikichi Ikura ◽  
...  
Keyword(s):  
Crystal Structures ◽  
Thermodynamic Analysis ◽  
Adaptor Proteins ◽  
Sh2 Domains ◽  
Src Homology 2 ◽  
Src Homology

scholarly journals (456) Abiotic Stress Responses in Cucumber (Cucumis sativus L.) Plants Expressing the Arabidopsis thaliana Transcriptional Activators-CBF1and CBF3

HortScience ◽  
2005 ◽  
Vol 40 (4) ◽  
pp. 1036E-1037
Author(s):  
Mohamed Tawfik ◽  
Alejandra Ferenczi ◽  
Daniel Enter ◽  
Rebecca Grumet
Keyword(s):  
Oxidative Stress ◽  
Abiotic Stress ◽  
Drought Stress ◽  
Stress Responses ◽  
Stress Resistance ◽  
Photochemical Efficiency ◽  
Leaf Damage ◽  
Cucumis Sativus L ◽  
Oxidative Stresses ◽  
Major Factors

Abiotic stresses (e.g., salinity, drought, cold, oxidative stress) can be major factors limiting plant productivity worldwide. We sought to increase abiotic stress resistance in cucumber by expressing the A. thaliana transcription factors CBF1and CBF3, which regulate genes responsible for enhanced dehydration-stress resistance in Arabidopsis. Our previous studies in the greenhouse and field demonstrated increased salinity tolerance in CBF-expressing cucumber lines. In the current studies, we tested response of CBF-cucumber plants to drought, chilling, and oxidative stresses. Transgenic cucumber plants subjected to drought stress in the greenhouse showed elevated levels of the stress-inducible compatible solute, proline, compared to the nontransgenic controls. Preliminary results also indicate greater photochemical efficiency in CBF-expressing plants under drought stress conditions compared to the nontransgenic controls. Under nonstressed conditions, there were no significant differences in growth between the transgenic and the nontransgenic cucumber plants; however, after a cycle of drought stress, CBF-cucumber lines had less growth reduction compared to the nontransgenic counterparts. The advantage in growth was less pronounced after a second cycle of drought. We also evaluated the transgenic cucumber plants under chilling conditions (i.e., low, nonfreezing temperatures within the 0 to 12 °C range). Based on plant height and cotyledon and leaf damage measurements, transgenic cucumber seedlings did not show chilling tolerance compared to the wild-type control. The response of transgenic CBF-cucumber plants to oxidative stress using methyl viologen is also being evaluated.

scholarly journals Genome-Wide Identification, Characterization and Expression Analysis of the CIPK Gene Family in Potato (Solanum tuberosum L.) and the Role of StCIPK10 in Response to Drought and Osmotic Stress

2021 ◽  
Vol 22 (24) ◽  
pp. 13535
Author(s):  
Rui Ma ◽  
Weigang Liu ◽  
Shigui Li ◽  
Xi Zhu ◽  
Jiangwei Yang ◽  
...  
Keyword(s):  
Abiotic Stress ◽  
Solanum Tuberosum ◽  
Plant Growth ◽  
Osmotic Stress ◽  
Stress Responses ◽  
Solanum Tuberosum L ◽  
Abiotic Stress Tolerance ◽  
Stomatal Closure ◽  
Interacting Protein ◽  
Reverse Transcription Pcr

The potato (Solanum tuberosum L.), one of the most important food crops worldwide, is sensitive to environmental stresses. Sensor–responder complexes comprising calcineurin B-like (CBL) proteins and CBL-interacting protein kinases (CIPKs) not only modulate plant growth and development but also mediate numerous stress responses. Here, using a Hidden Markov Model and BLAST searches, 27 CIPK genes were identified in potato and divided into five groups by phylogenetic analysis and into two clades (intron-poor and intron-rich) by gene structure analysis. Quantitative reverse-transcription PCR (qRT-PCR) assays revealed that StCIPK genes play important roles in plant growth, development and abiotic stress tolerance. Up-regulated expression of StCIPK10 was significantly induced by drought, PEG6000 and ABA. StCIPK10 enhances both the ability of potato to scavenge reactive oxygen species and the content of corresponding osmoregulation substances, thereby strengthening tolerance to drought and osmotic stress. StCIPK10 is located at the intersection between the abscisic acid and abiotic stress signaling pathways, which control both root growth and stomatal closure in potato. In addition, StCIPK10 interacts with StCBL1, StCBL4, StCBL6, StCBL7, StCBL8, StCBL11 and StCBL12, and is specifically recruited to the plasma membrane by StCBL11.

scholarly journals Genotoxic, Metabolic, and Oxidative Stresses Regulate the RNA Repair Operon ofSalmonella entericaSerovar Typhimurium

2018 ◽  
Vol 200 (23) ◽  
Author(s):  
Jennifer E. Kurasz ◽  
Christine E. Hartman ◽  
David J. Samuels ◽  
Bijoy K. Mohanty ◽  
Anquilla Deleveaux ◽  
...  
Keyword(s):  
Nucleic Acid ◽  
Stress Responses ◽  
Nitrogen Limitation ◽  
Selective Advantage ◽  
Stress Conditions ◽  
Rna Repair ◽  
Content Type ◽  
E Coli ◽  
Oxidative Stresses

ABSTRACTThe σ54regulon inSalmonella entericaserovar Typhimurium includes a predicted RNA repair operon encoding homologs of the metazoan Ro60 protein (Rsr), Y RNAs (YrlBA), RNA ligase (RtcB), and RNA 3′-phosphate cyclase (RtcA). Transcription from σ54-dependent promoters requires that a cognate bacterial enhancer binding protein (bEBP) be activated by a specific environmental or cellular signal; the cognate bEBP for the σ54-dependent promoter of thersr-yrlBA-rtcBAoperon is RtcR. To identify conditions that generate the signal for RtcR activation inS. Typhimurium, transcription of the RNA repair operon was assayed under multiple stress conditions that result in nucleic acid damage. RtcR-dependent transcription was highly induced by the nucleic acid cross-linking agents mitomycin C (MMC) and cisplatin, and this activation was dependent on RecA. Deletion ofrtcRorrtcBresulted in decreased cell viability relative to that of the wild type following treatment with MMC. Oxidative stress from peroxide exposure also induced RtcR-dependent transcription of the operon. Nitrogen limitation resulted in RtcR-independent increased expression of the operon; the effect of nitrogen limitation required NtrC. The adjacent toxin-antitoxin module,dinJ-yafQ, was cotranscribed with the RNA repair operon but was not required for RtcR activation, although YafQ endoribonuclease activated RtcR-dependent transcription. Stress conditions shown to induce expression the RNA repair operon ofEscherichia coli(rtcBA) did not stimulate expression of theS. Typhimurium RNA repair operon. Similarly, MMC did not induce expression of theE. colirtcBAoperon, although when expressed inS. Typhimurium,E. coliRtcR responds effectively to the unknown signal(s) generated there by MMC exposure.IMPORTANCEHomologs of the metazoan RNA repair enzymes RtcB and RtcA occur widely in eubacteria, suggesting a selective advantage. Although the enzymatic activities of the eubacterial RtcB and RtcA have been well characterized, the physiological roles remain largely unresolved. Here we report stress responses that activate expression of the σ54-dependent RNA repair operon (rsr-yrlBA-rtcBA) ofS. Typhimurium and demonstrate that expression of the operon impacts cell survival under MMC-induced stress. Characterization of the requirements for activation of this tightly regulated operon provides clues to the possible functions of operon componentsin vivo, enhancing our understanding of how this human pathogen copes with environmental stressors.

scholarly journals Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

2011 ◽  
Vol 71 (1) ◽  
pp. 91-98 ◽  
Author(s):  
IJ. Bechara ◽  
RHR. Destéfano ◽  
C. Bresil ◽  
CL. Messias
Keyword(s):  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Large Scale ◽  
Microbial Control ◽  
Fruit Fly ◽  
Control Agent ◽  
Immature Stages ◽  
Disease Cycle ◽  
Anastrepha Fraterculus ◽  
Hyphal Bodies

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Sign in / Sign up

Export Citation Format

Share Document