scholarly journals Regulation of Nuclear Gamma Interferon Gene Expression by Interleukin 12 (IL-12) and IL-2 Represents a Novel Form of Posttranscriptional Control

2002 ◽  
Vol 22 (6) ◽  
pp. 1742-1753 ◽  
Author(s):  
Deborah L. Hodge ◽  
Alfredo Martinez ◽  
John G. Julias ◽  
Lynn S. Taylor ◽  
Howard A. Young
Keyword(s):  
Gene Expression ◽  
Nk Cells ◽  
Cellular Response ◽  
Gamma Interferon ◽  
Nuclear Accumulation ◽  
Interleukin 12 ◽  
Mrna Accumulation ◽  
Nuclear Retention ◽  
Posttranscriptional Control ◽  
Ifn Γ

ABSTRACT Posttranscriptional control of gamma interferon (IFN-γ) gene expression has not been extensively studied and is poorly understood. Our work describes a posttranscriptional mechanism that modulates IFN-γ mRNA expression in stimulated natural killer (NK) cells through nuclear retention of the IFN-γ mRNA. This is evidenced by the elevated and sustained nuclear accumulation of both precursor and processed IFN-γ mRNAs in NK cells stimulated with interleukin-12 (IL-12). The elevated nuclear mRNA accumulation persists long after transcriptional activity has subsided and the rate of cytoplasmic IFN-γ mRNA accumulation has dropped. The IL-12-induced nuclear retention of the IFN-γ mRNA prevails until a secondary cytokine stimulus is received. The secondary stimulus, which is initiated by IL-2, mediates transcription-independent movement of the nuclear IFN-γ mRNA. Concurrent with the nucleocytoplasmic movement of the IFN-γ mRNA, we have observed increases in the amount of processed nuclear IFN-γ mRNA that are greater than that seen for the unprocessed IFN-γ mRNA. The increase in processed IFN-γ mRNA appears to be due to increased mRNA stability which then promotes increased nucleocytoplasmic shuttling of the mature IFN-γ mRNA. These data support a model whereby mobilization of nuclear IFN-γ mRNA stores allows NK cells to rapidly and robustly respond to secondary cytokine activators in a transcription-independent manner, thus shortening the time for overall cellular response to inflammatory signals.

scholarly journals Resistance to Acute Babesiosis Is Associated with Interleukin-12- and Gamma Interferon-Mediated Responses and Requires Macrophages and Natural Killer Cells

2003 ◽  
Vol 71 (4) ◽  
pp. 2002-2008 ◽  
Author(s):  
Irma Aguilar-Delfin ◽  
Peter J. Wettstein ◽  
David H. Persing
Keyword(s):  
Nk Cells ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
No Production ◽  
Cytokine Responses ◽  
Early Production ◽  
Ifn Γ ◽  
Crucial Part

ABSTRACT We examined the role of the cytokines gamma interferon (IFN-γ) and interleukin-12 (IL-12) in the model of acute babesiosis with the WA1 Babesia. Mice genetically deficient in IFN-γ-mediated responses (IFNGR2KO mice) and IL-12-mediated responses (Stat4KO mice) were infected with the WA1 Babesia, and observations were made on the course of infection and cytokine responses. Levels of IFN-γ and IL-12 in serum increased 24 h after parasite inoculation. The augmented susceptibility observed in IFNGR2KO and Stat-4KO mice suggests that the early IL-12- and IFN-γ-mediated responses are involved in protection against acute babesiosis. Resistance appears to correlate with an increase in nitric oxide (NO) production. In order to assess the contribution of different cell subsets to resistance against the parasite, we also studied mice lacking B cells, CD4+ T cells, NK cells, and macrophages. Mice genetically deficient in B lymphocytes or CD4+ T lymphocytes were able to mount protective responses comparable to those of immunosufficient mice. In contrast, in vivo depletion of macrophages or NK cells resulted in elevated susceptibility to the infection. Our observations suggest that a crucial part of the response that protects from the pathogenic Babesia WA1 is mediated by macrophages and NK cells, probably through early production of IL-12 and IFN-γ, and induction of macrophage-derived effector molecules like NO.

The Interleukin-12–Mediated Pathway of Immune Events Is Dysfunctional in Human Immunodeficiency Virus–Infected Individuals

Blood ◽  
1999 ◽  
Vol 94 (3) ◽  
pp. 1003-1011 ◽  
Author(s):  
Jason D. Marshall ◽  
Jihed Chehimi ◽  
Giorgia Gri ◽  
Jay R. Kostman ◽  
Luis J. Montaner ◽  
...  
Keyword(s):  
Immune Deficiency ◽  
Human Immunodeficiency Virus ◽  
Nk Cells ◽  
Mononuclear Cells ◽  
Cell Function ◽  
Interleukin 12 ◽  
Accessory Cell ◽  
Mrna Accumulation ◽  
Immunodeficiency Virus ◽  
Ifn Γ

Interleukin-12 (IL-12) is a potentially critical factor in the immune response against human immunodeficiency virus (HIV) because it is important for regulating proliferation and interferon-γ (IFN-γ) production by T cells and natural killer (NK) cells, antigen presentation and accessory cell function by macrophages and dendritic cells, and cytolytic activities of cytotoxic T-lymphocyte cells and NK cells, which are all functions known to be dysfunctional in patients with acquired immune deficiency syndrome. Peripheral blood mononuclear cells (PBMC) from HIV-infected patients have been previously shown to be deficient in the ability to produce IL-12 in response to the bacterial pathogen Staphylococcus aureus Cowan. In this study, impaired IL-12 production in cells from PBMC of HIV-infected patients compared with healthy donors was observed across a broad panel of stimuli derived from infectious pathogens with or without priming with cytokines such as IFN-γ and IL-4, which amplify the IL-12 induction signal. Analysis of p40 and p35 mRNA accumulation showed that reductions in both subunits contribute to the lower IL-12 secretion of cells from HIV-infected individuals. PBMC from HIV-infected donors also failed to upregulate the IL-12 receptor β2 chain (IL-12Rβ2) in response to mitogenic stimuli. The expression of the IL-12Rβ2 gene could, however, be restored by in vitro exposure to rIL-12. Thus, it is possible that a primary IL-12 defect may lead to secondary deficiencies in expression of the genes for IL-12Rβ2 and IFN-γ, thus amplifying immune deficiency during HIV infection.

scholarly journals The Protozoan Neospora caninum Directly Triggers Bovine NK Cells To Produce Gamma Interferon and To Kill Infected Fibroblasts

2006 ◽  
Vol 74 (2) ◽  
pp. 953-960 ◽  
Author(s):  
Preben Boysen ◽  
Siv Klevar ◽  
Ingrid Olsen ◽  
Anne K. Storset
Keyword(s):  
Nk Cells ◽  
Nk Cell ◽  
Neospora Caninum ◽  
Gamma Interferon ◽  
Functional Study ◽  
Interleukin 12 ◽  
Protozoan Infection ◽  
Autologous Fibroblasts ◽  
Ifn Γ

ABSTRACT Natural killer (NK) cells are considered to be key players in the early innate responses to protozoan infections, primarily indirectly by producing gamma interferon (IFN-γ) in response to cytokines, like interleukin 12 (IL-12). We demonstrate that live, as well as heat-inactivated, tachyzoites of Neospora caninum, a Toxoplasma-like protozoan, directly trigger production of IFN-γ from purified, IL-2-activated bovine NK cells. This response occurred independently of IL-12 but was increased by the addition of the cytokine. A similar IFN-γ response was measured in cocultures of NK cells and N. caninum-infected autologous fibroblasts. However, no NK cell-derived IFN-γ response was detected when cells were cultured with soluble antigens from the organism, indicating that intact tachyzoites or nonsoluble components are necessary for NK cell triggering. Furthermore, N. caninum-infected autologous fibroblasts had increased susceptibility to NK cell cytotoxicity compared to uninfected fibroblasts. This cytotoxicity was largely mediated by a perforin-mediated mechanism. The activating receptor NKp46 was involved in cytotoxicity against fibroblasts but could not explain the increased cytotoxicity against infected targets. Interestingly, N. caninum tachyzoites were able to infect cultured NK cells, in which tachyzoites proliferated inside parasitophorous vacuoles. Together, these findings underscore the role of NK cells as primary responders during a protozoan infection, describe intracellular protozoan infection of NK cells in vitro for the first time, and represent the first functional study of purified bovine NK cells in response to infection.

scholarly journals Cellular Mechanisms That Cause Suppressed Gamma Interferon Secretion in Endotoxin-Tolerant Mice

2001 ◽  
Vol 69 (9) ◽  
pp. 5249-5263 ◽  
Author(s):  
Tushar K. Varma ◽  
Tracy E. Toliver-Kinsky ◽  
Cheng Y. Lin ◽  
Aristides P. Koutrouvelis ◽  
Joan E. Nichols ◽  
...  
Keyword(s):  
T Cells ◽  
Nk Cells ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
Cellular Mechanisms ◽  
Macrophage Dysfunction ◽  
Cellular Mediators ◽  
Ifn Γ ◽  
Costimulatory Signals ◽  
Inducing Factors

ABSTRACT Endotoxin (lipopolysaccharide [LPS]) tolerance is a state of altered immunity characterized, in part, by suppression of LPS-induced gamma interferon (IFN-γ) expression. However, the cellular mediators regulating LPS-induced production of IFN-γ in normal mice and the effect of LPS tolerance on these mediators has not been well characterized. Our studies show that macrophage dysfunction is the primary factor causing suppressed IFN-γ expression in LPS-tolerant mice. Specifically, LPS-tolerant macrophages have a markedly impaired ability to induce IFN-γ secretion by T cells and NK cells obtained from either control or LPS-tolerant mice. However, T cells and NK cells isolated from LPS-tolerant mice produce normal levels of IFN-γ when cocultured with control macrophages or exogenous IFN-γ-inducing factors. Assessment of important IFN-γ-regulating factors showed that interleukin-12 (IL-12) and costimulatory signals provided by IL-15, IL-18, and CD86 are largely responsible for LPS-induced IFN-γ expression in control mice. IL-10 is an inhibitor of IFN-γ production in both the control and LPS-tolerant groups. Expression of IL-12 and the IL-12 receptor β1 (IL-12Rβ1) and IL-12Rβ2 subunits are suppressed in the spleens of LPS-tolerant mice. LPS-tolerant splenocytes also exhibit decreased production of IL-15 and IL-15Rα. However, expression of IL-18 and the B7 proteins CD80 and CD86 are unchanged or increased compared to controls after induction of LPS tolerance. CD28, a major receptor for B7 proteins, is also increased in the spleens of LPS-tolerant mice. Expression of the inhibitory cytokine IL-10 and the IL-10R are sustained after induction of LPS tolerance. These data show that suppression of IFN-γ production in LPS-tolerant mice is largely due to macrophage dysfunction and provide insight into the cellular alterations that occur in LPS tolerance. This study also better defines the factors that mediate LPS-induced IFN-γ production in normal mice.

scholarly journals Endotoxin-Induced Gamma Interferon Production: Contributing Cell Types and Key Regulatory Factors

2002 ◽  
Vol 9 (3) ◽  
pp. 530-543 ◽  
Author(s):  
Tushar K. Varma ◽  
Cheng Y. Lin ◽  
Tracy E. Toliver-Kinsky ◽  
Edward R. Sherwood
Keyword(s):  
Nk Cells ◽  
Cell Types ◽  
Nkt Cells ◽  
Gamma Interferon ◽  
Mouse Spleen ◽  
Interleukin 12 ◽  
Specific Cell ◽  
Regulatory Factors ◽  
Lps Challenge ◽  
Ifn Γ

ABSTRACT Gamma interferon (IFN-γ) is an important mediator of endotoxin (lipopolysaccharide [LPS])-induced immune responses. However, the specific cell types that produce IFN-γ in response to LPS and the cellular factors that regulate LPS-induced IFN-γ production have not been fully determined. The present studies were undertaken to characterize the cell populations that produce IFN-γ after LPS challenge in the spleens of mice and to determine the regulatory factors that modulate LPS-induced production of IFN-γ. Our studies show that the levels of splenic IFN-γ mRNA and protein production peak at 6 and 8 h, respectively, after systemic LPS challenge. Approximately 60% of IFN-γ-producing cells are natural killer (NK) cells (CD3−DX5+) and 25% are NKT cells (CD3+DX5+). Most of the remaining IFN-γ-producing cells are T cells (CD3+DX5−), macrophages, and dendritic cells. Functionally, interleukin-12 (IL-12) is the major IFN-γ-stimulating factor after LPS challenge, with costimulation provided by IL-15, IL-18, and B7 proteins. IL-10 is a major inhibitor of LPS-induced IFN-γ production. Unlike intact heat-killed gram-negative and gram-positive bacteria, the class II major histocompatibility complex did not play a functional role in LPS-induced IFN-γ production. LPS is a potent stimulus for splenic IL-10, IL-12 p40, and IL-15 mRNA expression, whereas IL-12 p35 and IL-18 mRNAs, as well as B7 proteins, are constitutively expressed in the mouse spleen. Of the factors studied, IL-18 serves as the most potent costimulus with IL-12 for IFN-γ production, followed by IL-15 and B7 proteins. These data demonstrate that NK cells and NKT cells are the most abundant IFN-γ-producing cells in the mouse spleen after LPS challenge and that IL-10 and IL-12 are key functional regulators of LPS-induced IFN-γ production.

scholarly journals Invariant NKT Cells Are Essential for the Regulation of Hepatic CXCL10 Gene Expression during Leishmania donovani Infection

2005 ◽  
Vol 73 (11) ◽  
pp. 7541-7547 ◽  
Author(s):  
Mattias Svensson ◽  
Soombul Zubairi ◽  
Asher Maroof ◽  
Fatima Kazi ◽  
Masaru Taniguchi ◽  
...  
Keyword(s):  
Gene Expression ◽  
T Cell ◽  
Nk Cells ◽  
Leishmania Donovani ◽  
Cell Receptor ◽  
Nkt Cells ◽  
Mrna Accumulation ◽  
Invariant Nkt Cells ◽  
Early Expression ◽  
Ifn Γ

ABSTRACT Gamma interferon (IFN-γ)-regulated chemokines of the CXC family have been implicated as key regulators of a variety of T-cell-dependent inflammatory processes. However, the cellular source(s) of IFN-γ that regulates their early expression has rarely been defined. Here, we have directly addressed this question in mice after Leishmania donovani infection. Comparison of CXCL10 mRNA accumulation in normal and IFN-γ-deficient mice confirmed an absolute requirement for IFN-γ for sustained (24 h) expression of CXCL10 mRNA accumulation in this model. In normal mice, IFN-γ was produced by both CD3int NK1.1+ NKT cells and CD3− NK1.1+ NK cells, as detected by intracellular flow cytometry. Strikingly, B6.Jα281−/− mice lacking NKT cells that express the invariant Vα14Jα18 T-cell-receptor α chain, although retaining a significant population of IFN-γ-producing NK cells and NKT cells, were unable to sustain CXCL10 mRNA accumulation. These data indicate that invariant NKT cells are indispensable for the regulation of hepatic CXCL10 gene expression during L. donovani infection.

scholarly journals Dendritic Cells Stimulated with Actinobacillus actinomycetemcomitans Elicit Rapid Gamma Interferon Responses by Natural Killer Cells

2004 ◽  
Vol 72 (9) ◽  
pp. 5089-5096 ◽  
Author(s):  
T. Kikuchi ◽  
C. L. Hahn ◽  
S. Tanaka ◽  
S. E. Barbour ◽  
H. A. Schenkein ◽  
...  
Keyword(s):  
Dendritic Cells ◽  
Nk Cells ◽  
Gingival Crevicular Fluid ◽  
Nk Cell ◽  
Primary Source ◽  
Peripheral Blood Lymphocytes ◽  
Gamma Interferon ◽  
Actinobacillus Actinomycetemcomitans ◽  
Interleukin 12 ◽  
Ifn Γ

ABSTRACT Human immunoglobulin G2 (IgG2) responses are gamma interferon (IFN-γ) dependent, and monocyte-derived dendritic cells (mDCs) promote IgG2 production. DCs spontaneously emerge from monocytes in cultures prepared from localized aggressive periodontitis (LagP) patients, and these patients have high levels of IgG2 that is reactive with Actinobacillus actinomycetemcomitans. These results prompted the hypothesis that an interaction between mDCs and A. actinomycetemcomitans promotes IFN-γ production, and IFN-γ is known to promote both immunopathology and protective IgG2. A. actinomycetemcomitans induced mDCs to produce interleukin-12 (IL-12), and the addition of A. actinomycetemcomitans and DCs to cultured peripheral blood lymphocytes elicited high levels of IFN-γ within just 24 h. In contrast, IL-4 was not detectable although DC-derived IL-10 production was apparent. A. actinomycetemcomitans-stimulated macrophages prepared from the same monocytes lacked the ability to induce IL-12 or IFN-γ responses. NK cells of the innate immune system were the primary source of this early IFN-γ, although CD8 T cells also contributed some. The NK cell-derived IFN-γ was IL-12 dependent, and A. actinomycetemcomitans-DC interactions were Toll-like receptor 4 dependent. A. actinomycetemcomitans and A. actinomycetemcomitans lipopolysaccharide (LPS) were more potent than Escherichia coli and E. coli LPS in the ability to induce DC IL-12 and IFN-γ. The ability of A. actinomycetemcomitans-stimulated DCs to induce NK cells to rapidly produce IFN-γ in the absence of detectable IL-4 suggests their potential for skewing responses toward Th1. This may help explain the presence of Th1-associated cytokines in gingival crevicular fluid (GCF) from LagP patients and the high levels of IgG2 in their serum and GCF that is reactive with A. actinomycetemcomitans.

scholarly journals Human Macrophage Gamma Interferon Decreases Gene Expression but Not Replication of Mycobacterium tuberculosis: Analysis of the Host-Pathogen Reciprocal Influence on Transcription in a Comparison of Strains H37Rv and CMT97

2001 ◽  
Vol 69 (12) ◽  
pp. 7262-7270 ◽  
Author(s):  
Giulia Cappelli ◽  
Pietro Volpe ◽  
Alessandro Sanduzzi ◽  
Alessandra Sacchi ◽  
Vittorio Colizzi ◽  
...  
Keyword(s):  
Gene Expression ◽  
Mycobacterium Tuberculosis ◽  
Transforming Growth Factor ◽  
Gamma Interferon ◽  
Host Cells ◽  
Cytokine Gene Expression ◽  
Interleukin 12 ◽  
Pcr Analysis ◽  
Human Macrophage ◽  
Ifn Γ

ABSTRACT Mycobacterium tuberculosis is an intracellular pathogen that readily survives and replicates in human macrophages (MΦ). Host cells have developed different mycobactericidal mechanisms, including the production of inflammatory cytokines. The aim of this study was to compare the MΦ response, in terms of cytokine gene expression, to infection with the M. tuberculosis laboratory strain H37Rv and the clinical M. tuberculosis isolate CMT97. Both strains induce the production of interleukin-12 (IL-12) and IL-16 at comparable levels. However, the clinical isolate induces a significantly higher and more prolonged MΦ activation, as shown by reverse transcription-PCR analysis of IL-1β, IL-6, IL-10, transforming growth factor beta, tumor necrosis factor alpha, and gamma interferon (IFN-γ) transcripts. Interestingly, when IFN-γ transcription is high, the number of M. tuberculosis genes expressed decreases and vice versa, whereas no mycobactericidal effect was observed in terms of bacterial growth. Expression of 11 genes was also studied in the two M. tuberculosis strains by infecting resting or activated MΦ and compared to bacterial intracellular survival. In both cases, a peculiar inverse correlation between expression of these genes and multiplication was observed. The number and type of genes expressed by the two strains differed significantly.

scholarly journals Bovine NK Cells Can Produce Gamma Interferon in Response to the Secreted Mycobacterial Proteins ESAT-6 and MPP14 but Not in Response to MPB70

2005 ◽  
Vol 73 (9) ◽  
pp. 5628-5635 ◽  
Author(s):  
Ingrid Olsen ◽  
Preben Boysen ◽  
Siri Kulberg ◽  
Jayne C. Hope ◽  
Gregers Jungersen ◽  
...  
Keyword(s):  
Nk Cells ◽  
Mononuclear Cells ◽  
Nk Cell ◽  
Specific Protein ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
Adherent Cells ◽  
Peripheral Blood Mononuclear ◽  
Young Cattle ◽  
Ifn Γ

ABSTRACT Bovine NK cells have recently been characterized and the present study describes the interaction between NK cells, antigen-presenting cells, and secreted mycobacterial proteins. Gamma interferon (IFN-γ) production by NK cells was seen in approximately 30% of noninfected calves in response to the Mycobacterium tuberculosis complex-specific protein ESAT-6, MPP14 from Mycobacterium avium subsp. paratuberculosis, and purified protein derivative (PPD) from M. tuberculosis. In contrast, no response was induced by MPB70, which is another M. tuberculosis complex-specific secreted antigen. The production of IFN-γ by NK cells in whole blood in response to ESAT-6 and MPP14 was demonstrated using intracellular staining together with surface labeling for the NK cell-specific receptor, NKp46, or CD3. Furthermore, the depletion of NK cells from peripheral blood mononuclear cells completely abolished the IFN-γ production. The response was mediated through stimulation of adherent cells and was largely independent of contact between adherent cells and the NK cells. Neutralization of interleukin-12 only partly inhibited IFN-γ production, showing that other cytokines were also involved. The demonstration of NK cell-mediated IFN-γ production in young cattle provides an explanation for the nonspecific IFN-γ response frequently encountered in young cattle when using the IFN-γ test in diagnosis of mycobacterial infections.

scholarly journals Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

2001 ◽  
Vol 69 (3) ◽  
pp. 1643-1649 ◽  
Author(s):  
Robert A. Gramzinski ◽  
Denise L. Doolan ◽  
Martha Sedegah ◽  
Heather L. Davis ◽  
Arthur M. Krieg ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
T Cells ◽  
Nk Cells ◽  
Gamma Interferon ◽  
Innate Immune ◽  
Interleukin 12 ◽  
Cpg Odn ◽  
Cpg Dinucleotides ◽  
Cpg Odns ◽  
Ifn Γ

ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoeliisporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Sign in / Sign up

Export Citation Format

Share Document