scholarly journals The Results of the Laboratory Studies of Harvesting the White Lupine by a Stripper Header with Fingers for Large Seed Crops

2020 ◽  
Vol 30 (3) ◽  
pp. 377-393
Author(s):  
Nikolay V. Aldoshin ◽  
Maxim A. Mosyakov
Keyword(s):  
Flow Line ◽  
Experimental Studies ◽  
Morphological Characteristics ◽  
Laboratory Studies ◽  
Technological Parameters ◽  
Complete Collection ◽  
Seed Collection ◽  
Large Seed ◽  
White Lupine ◽  
Seed Crops

Introduction. Agricultural machinery and devices used for harvesting white lupines do not provide a complete collection of seeds, which leads to the violation of agricultural requirements for the harvesting of leguminous crops. It is necessary to find new technological and technical solutions to reduce losses of seeds during this process. The most perspective solution to the problem of white lupine harvesting is the application of industrial flow line technology together with the improvement of the method to comb standing plants by a stripper header. Materials and Methods. The article presents the design of a laboratory setup with experimental working bodies, which allows simulating the process of harvesting white lupines by separating the seed part of plants in the field. The empirical method based on the theory of multi-factor experiment was used to substantiate the parameters and operating modes of the stripper header with fingers for large seed crops. The algorithm and results of experimental studies to determine the completeness of seed collection are presented. Results. The results of the laboratory studies of the stripper header with fingers for largeseeded crops to determine the qualitative indicators for the completeness of the collection of white lupine seeds are presented. It is determined that the maximum completeness of seed collection is 99.5%. Discussion and Conclusion. In studying the technological process of harvesting white Degas lupine seeds by a combing header with fingers for large-seeded crops under laboratory conditions, the physical and mechanical properties of plants were experimentally studied, their morphological characteristics were clarified, and the regimen-technological parameters of the harvesting header were determined to ensure seed loss within agrotechnical requirements (0.5%).

scholarly journals RESULTS OF FIELD RESEARCHES OF PELLETED BUCKWHEAT SEEDS WITH ORGANIC FERTILIZERS BASED ON HUMIC ACIDS WITH SUBSTANTIATION OF CONSTRUCTIVE AND TECHNOLOGICAL PARAMETERS OF CENTRIFUGAL PELLETER WITH BLADE REFLECTOR

2018 ◽  
Vol 56 (3) ◽  
pp. 357-365
Author(s):  
V. R. Petrovets ◽  
D. A. Mikheev
Keyword(s):  
Humic Acids ◽  
Crop Production ◽  
Seed Quality ◽  
Experimental Studies ◽  
Spherical Shape ◽  
Organic Fertilizers ◽  
Technological Parameters ◽  
Seeding Rate ◽  
Presowing Treatment ◽  
Seed Crops

One can obtain high yields of crops only when seeds with high varietal and sowing qualities are used for sowing. Various methods of presowing processing are used to improve the seed quality. Presowing seed treatment not only improves germination, but also eliminates seeds from pathogens, significantly increases their viability and improves young crops yield. One of the most promising ways of presowing treatment of small and irregular shape seeds is pelleting. This method helps to increase the seeds size and acquire a spherical shape, which greatly simplifies their sowing and allows to accurately observe the seeding rate. The paper presents design of a centrifugal pelleter with blade reflector, the results of studying the process of buckwheat seeds pelleting, and its best design and technological parameters are determined based on those when organic fertilizers based on humic acids were used as material for pelleting. Factors significantly affecting seed pelleting in a centrifugal pelleter with blade reflector were determined, the choice of objective function and criterion for improving the process are substantiated. A dependence describing the process of seed pelleting in a pelleter was obtained as a result of the regression analysis of the obtained results of experimental studies. The obtained results can be used in the field of crop production in agricultural production during presowing treatment of small seed crops and agricultural engineering during development of centrifugal pelleters with blade reflectors.

A possibility of using nickel concentrate, obtained as a result of hydrometallurgical enrichment of manganese-containing raw materials, at steel alloying

2020 ◽  
Vol 76 (7) ◽  
pp. 709-715
Author(s):  
O. Yu. Kichigina
Keyword(s):  
Raw Materials ◽  
Experimental Studies ◽  
Selective Extraction ◽  
Technological Parameters ◽  
Nickel Iron ◽  
Nickel Recovery ◽  
Nickel Concentrate ◽  
Steel Alloying ◽  
High Degree ◽  
Comprehensive Processing

At production of stainless steel expensive alloying elements, containing nickel, are used. To decrease the steel cost, substitution of nickel during steel alloying process by its oxides is an actual task. Results of analysis of thermodynamic and experimental studies of nickel reducing from its oxide presented, as well as methods of nickel oxide obtaining at manganese bearing complex raw materials enrichment and practice of its application during steel alloying. Technology of comprehensive processing of complex manganese-containing raw materials considered, including leaching and selective extraction out of the solution valuable components: manganese, nickel, iron, cobalt and copper. Based on theoretical and experiment studies, a possibility of substitution of metal nickel by concentrates, obtained as a result of hydrometallurgical enrichment, was confirmed. Optimal technological parameters, ensuring high degree of nickel recovery out of the initial raw materials were determined. It was established, that for direct steel alloying it is reasonable to add into the charge pellets, consisting of nickel concentrate and coke fines, that enables to reach the through nickel recovery at a level of 90%. The proposed method of alloying steel by nickel gives a possibility to decrease considerably steel cost at the expense of application of nickel concentrate, obtained out of tails of hydrometallurgical enrichment of manganese-bearing raw materials, which is much cheaper comparing with the metal nickel.

scholarly journals Mass occurrence and habitat selection of Common Redpolls (Carduelis flammea) after a large seed crop year: snow-covered ground facilitates food access

2021 ◽  
Author(s):  
Svein Dale
Keyword(s):  
Climate Change ◽  
Habitat Selection ◽  
Snow Cover ◽  
Breeding Season ◽  
Boreal Forests ◽  
Large Seed ◽  
Mass Occurrence ◽  
Seed Crops ◽  
Ecosystem Changes ◽  
Selection Of

AbstractIn boreal forests, food supplies typically have cyclic variations, and many species here fluctuate in numbers from year to year. One group of species showing large variations in population size is birds specialized on seeds from masting trees. Here, I analyze spatial patterns of a mass occurrence and habitat selection of the Common Redpoll (Carduelis flammea) during the breeding season in southeastern Norway in 2020 after a year with large seed crops from Norway Spruce (Picea abies) and Downy Birch (Betula pubescens). I found that Common Redpoll numbers increased with elevation and towards the northwest. Numbers were also strongly and positively correlated with snow depth in early April when snow was present mainly above 400 m elevation. Sites with snow cover in early April (30% of all sites) held 96.4% of all individuals recorded. Field observations indicated that Common Redpolls foraged extensively for spruce seeds on the snow until the end of May when young were independent. I suggest that the mass occurrence was due to a unique combination of exceptionally large seed crops of two tree species coinciding in the same year. The masting produced large amounts of food both for overwintering (birch seeds) and for breeding (spruce seeds), and during the breeding season snow cover facilitated access to food resources. Dependency of Common Redpolls on snow cover suggests that climate change may negatively impact some seed-eaters in boreal regions. On the other hand, higher temperatures may induce more frequent masting which may be beneficial for seed-eaters. Thus, climate change is likely to lead to complex ecosystem changes in areas where snow cover may disappear.

scholarly journals RESEARCH OF THE OF BULK MATERIAL MOVEMENT PROCESS IN THE INACTIVE ZONE BETWEEN SCREW SECTIONS

2020 ◽  
Vol 60 (1) ◽  
pp. 261-268
Author(s):  
O.M. Trokhaniak ◽  
R.B. Hevko ◽  
O.L. Lyashuk ◽  
T.A. Dovbush ◽  
B.V. Pohrishchuk ◽  
...  
Keyword(s):  
Optimal Design ◽  
Bulk Material ◽  
Experimental Studies ◽  
Screw Conveyor ◽  
Technological Parameters ◽  
Movement Process ◽  
Curved Paths ◽  
Agricultural Materials

The article presents the results of theoretical and experimental studies of the process of moving bulk material in the inactive zone between hinged screw sections of a flexible screw conveyor. The influence of the gap between the edges of adjacent screw sections and the magnitude of their circular displacement on the process of continuous transportation of bulk material is presented. The results of theoretical and experimental studies are compared. This will allow choosing the optimal design, kinematic and technological parameters of the developed sectional screw working body when transporting bulk agricultural materials along curved paths, both in horizontal and inclined directions, as well as along curved paths.

scholarly journals RESEARCH OF PHYSICAL AND MECHANICAL PROPERTIES OF WOOD-FIBER MATERIALS

2020 ◽  
pp. 451-457
Author(s):  
Aleksandr Yur'yevich Vititnev ◽  
Yuriy Davydovich Alashkevich ◽  
Natal'ya Geral'dovna Chistova ◽  
Roman Aleksandrovich Marchenko ◽  
Venera Nurullovna Matygullina
Keyword(s):  
Mechanical Properties ◽  
Wood Fiber ◽  
Experimental Studies ◽  
Physical And Mechanical Properties ◽  
Production Method ◽  
Strength Properties ◽  
Grinding Process ◽  
Technological Parameters ◽  
Fiber Materials ◽  
Traditional Construction

This paper presents the results of experimental studies of the physical and mechanical properties of wood-fiber boards of the wet production method when regulating the design and technological parameters of the grinding process. This allowed us to determine the influence of the working clearance between the grinding discs and the concentration of fibre mass with the subject to of quality change wood fiber after defibrator using the developed construction of the disc fibrillation action on the physico-mechanical properties of boards. As a result of the experiment, regression models were obtained that adequately describe the studied grinding process and allow predicting the values of physical and mechanical properties of the finished product depending on the established  parameters process. A comparative analysis of the size and quality characteristics of the fiber semi-finished product and its fractional composition when using a developed construction the disc of refiner fibrillation action and a traditional design used in industry is carried out. The preferential efficiency of the grinding process under the fibrillating effect the disc of refiner in comparison with the traditional construction disc of refiner is established. As a result, there is a significant improvement in the quality indicators of the fiber semi-finished product and its composition due to the formation and predominance in the total mass of long and thin, respectively, flexible fibrillated fibers with high tile-forming properties, which allows to increase the strength properties of the product (by 20–25%), without using binding resins.

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

scholarly journals Heat transfer in the mold during vertical continuous casting of steel

2018 ◽  
pp. 26-30
Author(s):  
E. I. Marukovich ◽  
E. B. Demchenko
Keyword(s):  
Heat Transfer ◽  
Temperature Regime ◽  
Thermal State ◽  
Effective Means ◽  
Experimental Studies ◽  
Casting Process ◽  
Continuous Casting Of Steel ◽  
Technological Parameters ◽  
Casting Method ◽  
Calculation Technique

The analysis of the performed researches has shown that the offered calculation technique is an effective means of management of formation process in casting. The found dependences and experimental data allow to calculate the specific value of the exactм heat flux in a given range of technological parameters obtained during a series of successful experiments for a particular casting method.Having the results of studies of the temperature regime of the mold during casting of a certain size and profile, it is possible to calculate the thermal state of the mold for the same casting process, but for the production of castings of any other size and profile.Having a certain amount of information on the temperature regime of the mold at different casting methods, you can use the solutions obtained to become the owner of a database containing the necessary information for solving the problems of solidification of the casting. In the subsequent design of equipment and equipment there is no need for additional experimental studies and analysis of the results.

scholarly journals INFLUENCE OF CONSTRUCTIVE AND TECHNOLOGICAL PARAMETERS OF THE UNIT FOR STRIP TILL ON THE LUMPINESS

2020 ◽  
Author(s):  
G. Golub ◽  
◽  
A. Dvornyk
Keyword(s):  
Winter Wheat ◽  
Relative Position ◽  
Experimental Studies ◽  
Movement Speed ◽  
Technological Parameters ◽  
Depth Of Processing ◽  
Processing Depth ◽  
Economic Methods ◽  
Strip Tillage

The goal of the work. Investigate the influence of the relative position of the depth of processing with a chisel, the speed of movement of the unit and the distance between the cutting side discs on the lumpiness of the processed strip. Methods of research: analytical - quantitative determination of the quality of strip tillage; laboratory-field - for research, an experimental installation was completed with an MTZ-892 tractor and a section of the unit for strip tillage; statistical with generally accepted agronomic and economic methods. Results. Experimental studies of changes in the design and technological parameters of the unit for strip processing with the determination of lumpiness have been carried out. To study the main parameters, the depth of processing of the subsoiler (chisel) is taken from 13 to 27 cm, the distance between the cutting side discs is from 10 to 30 cm, the speed of the MTA is from 4 to 11 km/h. Unchanged parameters during the study: the distance from the axis of the front disc to the chisel is 50 cm, the distance from the chisel to the axis of the cutting side discs is 50 cm, the immersion depth of the cutting side discs is 10 cm. Experimental background is winter wheat stubble. Soil cultivation for winter wheat - deep (18 cm) disking, before that plowing to a depth of 25 cm. According to the research results, graphs of the dependence of lumpiness on the relative position of the chisel, cutting side discs and changes in the speed of the MTA were built. As the speed and distance between the side cutting discs increase, the lumpiness value decreases. Conclusions. Based on the results of the studies, the dependences of lumpiness on the relative position of the chisel and cutting side disks were obtained when the speed of the MTA was changed. It was determined that with an increase in the processing depth, the distance between the cutting side discs of 20 cm and the MTA movement speed of 7.5 km / h, a uniform increase in lumpiness is observed. The distance between the side cutting discs of 10 cm is not suitable for work.

scholarly journals The influence of brushing on the surface quality of aluminium

2018 ◽  
Vol 178 ◽  
pp. 01015 ◽  
Author(s):  
Uwe Teicher ◽  
Richard Schulze ◽  
Alexander Brosius ◽  
Andreas Nestler
Keyword(s):  
Surface Quality ◽  
Force Measurement ◽  
Experimental Studies ◽  
Cutting Speed ◽  
Technological Parameters ◽  
Milling Operation ◽  
Metal Machining ◽  
Modelling Methods ◽  
Main Influence

The extension of technical capabilities of machine centres for complete machining of components can improve their performance. In the field of sheet metal machining, the objective beside the classic milling operation was a generation of functional surfaces by face brushing. The experimental studies have probed the influence of tools and technological parameters on the surface quality. In addition to an analysis of the relevant roughness parameters the formation of the surface topography was analysed by several measurement methods. By the application of force measurement, the results of the surface quality can be interpreted additionally. It could be shown that the feed rate in contrast to the cutting speed has the main influence on the surface roughness. A peculiarity is given by the parameter-based width of cut that should be known for reliable process control. The acquired data can be applied in the form of process characteristic fields for further processing with simulation and modelling methods.

scholarly journals Synthesis of Mg–Zn–Nd Master Alloy in Metallothermic Reduction of Neodymium from Fluoride–Chloride Melt

Crystals ◽  
2020 ◽  
Vol 10 (11) ◽  
pp. 985 ◽  
Author(s):  
Ilia Beloglazov ◽  
Sergey Savchenkov ◽  
Vladimir Bazhin ◽  
Rudolf Kawalla
Keyword(s):  
Master Alloy ◽  
Thermal Effects ◽  
Experimental Studies ◽  
Zinc Alloy ◽  
Salt Mixture ◽  
Technological Parameters ◽  
Metallothermic Reduction ◽  
Chloride Melt ◽  
Ternary Intermetallic Compounds ◽  
Degree Of Extraction

In the presented article, a differential thermal analysis was carried out and the temperatures of thermal effects were established that arise during the reduction of neodymium from a technological salt mixture KCl–NaCl–CaCl2–NdF3 with a magnesium–zinc alloy. The results of experimental studies on the reduction of neodymium from a fluoride–chloride melt in a shaft electric furnace at temperatures of 550, 600, 650, 700 °C are presented. In order to increase the degree of extraction of neodymium into the Mg–Zn–Nd master alloy, the study of the influence of technological parameters on the degree of extraction of neodymium was carried out. It was experimentally proven that when zinc is added to a reducing agent (magnesium), the degree of extraction of neodymium into the master alloy is 99.5–99.7%. The structure of the obtained master alloy samples, characterized by a uniform distribution of ternary intermetallic compounds (Mg3,4NdZn7) in the volume of a double magnesium–zinc eutectic, was studied by optical and electron microscopy.

Sign in / Sign up

Export Citation Format

Share Document