scholarly journals RNA-seq and metabolome revealed counter effect of chitosan against Botrytis cinerea on grape berries

2019 ◽  
Author(s):  
tariq pervaiz ◽  
Haifeng Jia ◽  
Peian Zhang ◽  
Muhammad Salman Haider ◽  
Suwen Lu ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Developmental Stages ◽  
Disease Incidence ◽  
Signal Transduction Pathway ◽  
Gray Mold ◽  
Metabolome Analysis ◽  
Grape Berries ◽  
Grey Mold ◽  
Genes Encoding ◽  
Anti Fungal

Abstract Background: Plants have great potential to protect against biotic and abiotic stresses. Hence, the interaction between defense signaling networks is incredible, which can either be activated with the application of growth elicitors or antimicrobial organic compounds. Results: In this study, chitosan (15kDa) is used against grey mold (Botrytis cinerea) in two grape varieties (Shine-Muscat and Kyoho). The findings depicted that the interaction of DEGs and KEGGs in control and treated samples of grapevine, which provides the evidence for selection of gray mold defense responsive genes and chitosan for subsequent application in grapevine production/postharvest. The genes encoding cyclic nucleotide gated ion channels (CNGCs) and CaM/CML expressed a large number of transcripts, meanwhile, in treated samples, CaM/CML and RPS2 showed the highest number of up-regulated genes. In plant hormone signal transduction pathway, treated samples AUXIAA and SAUR again the highest number of transcripts were found. In correlation with metabolome analysis, 20 differentially expressed metabolites were recorded. In the negative correlation in the control samples of Kyoho vs Shine mascate showed 224 and 157 up and down-regulated respectively. Moreover, antioxidants were also significantly regulated with the chitosan application and reduced the lesion diameter, water loss and disease incidence up to 12 days. In both varieties, the chitosan treatment superoxide dismutase, peroxidase, Malondialdehyde, catalase, and proline content was significantly increased during storage. Conclusion: The results depicted that at gene expression levels was varied at different fruit growth developmental stages, and the most effective in case of plant-pathogen interaction. Chitosan is seen to be more effective in both varieties and it acts as an anti-fungal agent. The transcriptomic study also confirmed that at the transcriptome level expression was higher in treated samples, however in general transcription factor have not much affected with chitosan application.

scholarly journals Identification of epiphytic yeasts and bacteria with potential for biocontrol of grey mold disease on table grapes caused by Botrytis cinerea

2018 ◽  
Vol 16 (1) ◽  
pp. e1002 ◽  
Author(s):  
Kazem Kasfi ◽  
Parissa Taheri ◽  
Behrooz Jafarpour ◽  
Saeed Tarighi
Keyword(s):  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Gray Mold ◽  
Antagonistic Activity ◽  
Antagonistic Effect ◽  
Bacterial Isolates ◽  
Thompson Seedless ◽  
Grape Berries ◽  
Table Grapes

The objective of this study was to identify grapevine epiphytic yeasts and bacteria for biocontrol of Botrytis cinerea on grapes. Antagonistic yeasts and bacteria were isolated from the epiphytic flora associated with grape berries and leaves cv. ‘Thompson seedless’ from vineyards in Iran and identified by sequencing the conserved genomic regions. A total of 130 yeast and bacterial isolates from the surface of grapevine were screened in vitro for determining their antagonistic effect against B. cinerea and used to control postharvest gray mold. Among the 130 isolates, five yeasts and four bacterial isolates showed the greatest antagonistic activity in vitro against B. cinerea. Two yeasts species including Meyerozyma guilliermondii and Candida membranifaciens had high antagonistic capability against the pathogen. Also, 4 bacterial isolates belonging to Bacillus sp. and Ralstonia sp. showed significant biocontrol effect against B. cinerea. The isolates were capable of producing volatile and non-volatile substances, which suppressed the pathogen growth. The antagonistic activity of selected yeasts and bacteria against the pathogen was investigated on wounded berries of ‘Thompson seedless’. On small clusters with intact berries, all of the antagonistic isolates considerably reduced the decay on grape berries and inhibition of gray mold incidence on fruits treated by these isolates was less than 50%, except for the isolate N1, which had higher capability in inhibiting the disease incidence. These results suggest that antagonist yeasts and bacteria with potential to control B. cinerea on grape can be found in the microflora of grape berries and leaves.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals Characterization of Botrytis cinerea From Commercial Cut Flower Roses

Plant Disease ◽  
2019 ◽  
Vol 103 (7) ◽  
pp. 1577-1583 ◽  
Author(s):  
M. Muñoz ◽  
J. E. Faust ◽  
G. Schnabel
Keyword(s):  
Botrytis Cinerea ◽  
Fungicide Resistance ◽  
Management Practices ◽  
Cultural Practices ◽  
Disease Incidence ◽  
Resistance Management ◽  
Gray Mold ◽  
Economic Losses ◽  
Cut Flower ◽  
Aspergillus Brasiliensis

Botrytis cinerea Pers. infects cut flower roses (Rosa × hybrida L.) during greenhouse production and gray mold symptoms are often expressed in the postharvest environment, resulting in significant economic losses. Disease management is based on cultural practices and preventative chemical treatments; however, gray mold outbreaks continue to occur. Rose tissues from six commercial shipments from two greenhouses in Colombia were evaluated to determine the Botrytis species composition as well as identify other pathogens present, gray mold incidence and severity, and fungicide resistance profiles. Botrytis isolates (49 total) were grouped into six morphological phenotypes, and all were identified to be B. cinerea sensu stricto. Disease incidence was higher in the petals than in the stem, stamen, ovary, sepal, or leaf tissues. Other fungi were isolated infrequently and included Alternaria alternata, Cladosporium cladosporioides, Epicoccum nigrum, Penicillium citrinum, Aspergillus brasiliensis, and Diplodia sp. Fungicide resistance profiles were determined using previously established discriminatory doses. Isolates resistant to thiophanate-methyl, iprodione, boscalid, and cyprodinil were found frequently in all shipments and in both greenhouses. The frequency of resistance to penthiopyrad, fenhexamid, fluopyram, isofetamid, and fludioxonil varied between shipments and greenhouses. No resistance to pydiflumetofen was observed at the discriminatory doses tested. Isolates with resistance to multiple chemical classes were commonly found. These results indicate that fungicide resistance management practices may improve preharvest and postharvest gray mold control of cut flower roses.

scholarly journals Priming of Defense Systems and Upregulation of MYC2 and JAZ1 Genes after Botrytis cinerea Inoculation in Methyl Jasmonate-Treated Strawberry Fruits

Plants ◽  
2020 ◽  
Vol 9 (4) ◽  
pp. 447 ◽  
Author(s):  
Felipe Valenzuela-Riffo ◽  
Paz E. Zúñiga ◽  
Luis Morales-Quintana ◽  
Mauricio Lolas ◽  
Marcela Cáceres ◽  
...  
Keyword(s):  
Methyl Jasmonate ◽  
Botrytis Cinerea ◽  
Defense Responses ◽  
Gray Mold ◽  
The Past ◽  
Defense Systems ◽  
Meja Treatment ◽  
Fruit Development And Ripening ◽  
Genes Encoding ◽  
And Control

Several attempts have been made to study the effects of methyl jasmonate (MeJA) on plants in the past years. However, the comparative effects of the number and phenological time of MeJA applications on the activation of defense systems is currently unknown in strawberries. In the present research, we performed three field treatments during strawberry (Fragaria × ananassa ‘Camarosa’) fruit development and ripening which consisted of differential MeJA applications at flowering (M3), and the large green (M2 and M3) and red ripe (M1, M2, and M3) fruit stages. We also checked changes in gene expression related to plant defense against Botrytis cinerea inoculation post-harvest. In M3 treatment, we observed an upregulation of the anthocyanin and lignin contents and the defense-related genes, encoding for chitinases, β-1,3-glucanases and polygalacturonase-inhibiting proteins, after harvest (0 hpi), along with the jasmonate signaling-related genes FaMYC2 and FaJAZ1 at 48 h after B. cinerea inoculation (48 hpi) during postharvest storage. Although we did not find differences in gray mold incidence between the MeJA treatments and control, these results suggest that preharvest MeJA treatment from the flowering stage onwards (M3) primes defense responses mediated by the upregulation of different defense-related genes and retains the upregulation of MYC2 and JAZ1 at 48 hpi.

scholarly journals First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia

Plant Disease ◽  
2005 ◽  
Vol 89 (8) ◽  
pp. 910-910 ◽  
Author(s):  
J. E. Woodward ◽  
T. B. Brenneman ◽  
R. C. Kemerait ◽  
A. K. Culbreath ◽  
J. R. Clark
Keyword(s):  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Block Design ◽  
Gray Mold ◽  
American Phytopathological Society ◽  
Breeding Programs ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Wilt Virus

Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 μm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as “unpublished observations” (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262–333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10–11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.

scholarly journals A Botrytis cinerea Population from a Single Strawberry Field in Germany has a Complex Fungicide Resistance Pattern

Plant Disease ◽  
2015 ◽  
Vol 99 (8) ◽  
pp. 1078-1086 ◽  
Author(s):  
Anja Grabke ◽  
Gerd Stammler
Keyword(s):  
Amino Acid ◽  
Botrytis Cinerea ◽  
Amino Acid Change ◽  
Efflux Pump ◽  
Disease Incidence ◽  
Gray Mold ◽  
Resistance Pattern ◽  
Lower Sensitivity ◽  
Multidrug Efflux Pump ◽  
Site Specific

Gray mold, caused by the fungus Botrytis cinerea, is one of the most important diseases of strawberry in Germany. The application of site-specific fungicides remains the main strategy to reduce disease incidence and severity in the field. Isolates (n = 199) were collected from fungicide-treated strawberry fruit at a German research site with a long history of fungicide efficacy trials against gray mold. Sensitivities to the six site-specific botryticides registered in Germany were determined using microtiter assays. Values for the concentration of a fungicide at which fungal development is inhibited by 50% (EC50) ranged from 0.03 to ≥30 ppm for the succinate dehydrogenase inhibitor boscalid, 0.015 to ≥10 ppm for the hydroxyanilide fenhexamid, 0.009 to 0.739 ppm for the phenylpyrrole fludioxonil, 0.55 to 43.45 ppm for the dicarboximide iprodione, 0.021 to ≥3 ppm for the quinone outside inhibitor pyraclostrobin, and 0.106 to ≥30 ppm for the anilinopyrimidine pyrimethanil. Pyrosequencing revealed that amino acid substitutions in the target proteins Bos1 (I365S/N, V368F + Q369H), CytB (G143A), Erg27 (F412S), and SdhB (P225F, N230I, and H272R/Y) were associated with reduced sensitivity levels to the corresponding fungicide classes. In most cases, isolates with a decreased sensitivity to fludioxonil showed a reduced sensitivity to tolnaftate. This reduction is considered to be an indication of multidrug efflux pump activity. The amino acid change I365S, I365N, or V368F + Q369H in Bos1 and H272R in SdhB by itself showed EC50 values of 3.99 to 14.73 ppm, 3.87 to 5.37 ppm, 4.81 to 15.63 ppm, and 2.071 to ≥30 ppm, respectively. When isolates that contained one of these mutations were also multidrug resistant, the ranges of EC50 values shifted to 6.47 to 43.45 ppm for I365S, 7.28 to 29.84 ppm for I365N, 6.89 to 26.67 ppm for V368F + Q369H, and ≥30 ppm for H272R. The reported data suggest that the combination of multidrug resistance and an amino acid change in the target site may result in a lower sensitivity to the fungicides than one resistance mechanism by itself. Although 20% of the population analyzed was sensitive to all six different chemical classes, the majority showed reduced sensitivity to one (6%), two (13%), three (23%), four (17%), five (11%), and six (11%) different fungicides.

scholarly journals Antifungal Activity of Eugenol Derivatives against Botrytis Cinerea

Molecules ◽  
2019 ◽  
Vol 24 (7) ◽  
pp. 1239 ◽  
Author(s):  
Andrés Olea ◽  
Angelica Bravo ◽  
Rolando Martínez ◽  
Mario Thomas ◽  
Claudia Sedan ◽  
...  
Keyword(s):  
Antifungal Activity ◽  
Botrytis Cinerea ◽  
Chemical Structure ◽  
Gray Mold ◽  
Resistant Isolate ◽  
Effective Control ◽  
Grey Mold ◽  
Ic50 Values ◽  
Agricultural Industries ◽  
The Relationship

Botrytis cinerea is a worldwide spread fungus that causes the grey mold disease, which is considered the most important factor in postharvest losses in fresh fruit crops. Consequently, the control of gray mold is a matter of current and relevant interest for agricultural industries. In this work, a series of phenylpropanoids derived from eugenol were synthesized and characterized. Their effects on the mycelial growth of a virulent and multi-resistant isolate of B. cinerea (PN2) have been evaluated and IC50 values for the most active compounds range between 31–95 ppm. The antifungal activity exhibited by these compounds is strongly related to their chemical structure, i.e., increasing activity has been obtained by isomerization of the double bond or introduction of a nitro group on the aromatic ring. Based on the relationship between the fungicide activities and chemical structure, a mechanism of action is proposed. Finally, the activity of these compounds is higher than that reported for the commercial fungicide BC-1000 that is currently employed to combat this disease. Thus, our results suggest that these compounds are potential candidates to be used in the design of new and effective control with inspired natural compounds of this pathogen.

scholarly journals Postharvest Biological Control of Botrytis cinerea on Kiwifruit by Volatiles of [Isabella] Grapes

2004 ◽  
Vol 94 (12) ◽  
pp. 1280-1285 ◽  
Author(s):  
Eleni K. Kulakiotu ◽  
Constantine C. Thanassoulopoulos ◽  
Evangelos M. Sfakiotakis
Keyword(s):  
Biological Control ◽  
Botrytis Cinerea ◽  
Inhibitory Action ◽  
Developmental Stages ◽  
Gray Mold ◽  
Biological Action ◽  
Disease Development ◽  
Vitis Labrusca ◽  
In Vivo Experiments

The potential of volatile substances emitted by ‘Isabella’ grapes (Vitis labrusca) to control gray mold (Botrytis cinerea) on ‘Hayward’ kiwifruit (Actinidia deliciosa) was studied. The closed Mariotte system was used as a bioassay method to analyze quantitatively the biological action of these volatiles on B. cinerea growth. In vivo experiments compared the effects of volatiles from ‘Isabella’ grapes versus volatiles from ‘Roditis’ grapes (V. vinifera) and a B. cinerea control on the growth and disease development of B. cinerea on kiwifruit. The effect of the volatiles on the growth of B. cinerea was tested at various temperatures and times of inoculation after the wounding of kiwifruit, as well as using various weights and developmental stages of the grapes. The ‘Isabella’ volatiles limited the incidence of infection by reducing both the inoculum density and the activity of the pathogen. The weight and developmental stage of the grapes were important in the degree of inhibitory action of the ‘Isabella’ volatiles. The inhibitory action was more pronounced at 21°C irrespective of the inoculation time after wounding. The study shows the potential for successful biological control of B. cinerea on kiwifruit by volatiles from ‘Isabella’ grapes.

scholarly journals How Does Botrytis cinerea Infect Red Raspberry?

2018 ◽  
Vol 108 (11) ◽  
pp. 1287-1298 ◽  
Author(s):  
O. Kozhar ◽  
T. L. Peever
Keyword(s):  
Botrytis Cinerea ◽  
Pacific Northwest ◽  
Air Temperature ◽  
Developmental Stages ◽  
Management Strategies ◽  
Gray Mold ◽  
Leaf Wetness ◽  
Red Raspberry ◽  
Mature Fruit ◽  
Inoculum Level

Botrytis cinerea, causal agent of gray mold, is one of the most important pathogens affecting raspberry in the U.S. Pacific Northwest and worldwide. Fungicides are currently applied to control the disease starting from 5 to 10% bloom and continuing on a calendar basis throughout the season rather than according to inoculum level or infection risk primarily because the disease cycle on red raspberry is poorly understood. Botrytis cinerea was isolated from raspberry flowers and fruit sampled at seven developmental stages during each of 2015 and 2016 in a northwestern Washington raspberry field untreated with fungicides. Incidence of colonization of flowers was low (15% of total sampled flowers), but increased as fruit developed, and peaked in mature fruit (67% of total sampled fruit). In the early stages of flower development, B. cinerea recovery was greatest from the carpel (80% of carpels colonized) compared with other floral organs. As fruit matured, additional floral parts were colonized by B. cinerea, possibly facilitating secondary internal or external infections of mature fruit. Average weekly minimum air temperature, average weekly night air temperature, cumulative rain, average weekly leaf wetness percentage, and duration of leaf wetness >90% were significantly positively correlated with B. cinerea colonization of raspberry in NW Washington during two seasons of this study. Our data does not support the hypothesis that the bloom period is the critical window for B. cinerea colonization of red raspberry and suggest that later colonization of developing fruit may be more important for gray mold development on raspberry. The outcomes of this research provide useful information for improvement of gray mold disease management strategies for red raspberry in NW Washington and elsewhere.

scholarly journals First Report of Iprodione Resistance in Botrytis cinerea on Blackberry from South Carolina

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1481-1481
Author(s):  
F. P. Chen ◽  
X. L. Liu ◽  
X. P. Li ◽  
G. Schnabel
Keyword(s):  
South Carolina ◽  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Gray Mold ◽  
Resistant Isolate ◽  
Cross Resistance ◽  
Broad Host Range ◽  
Paper Strip ◽  
Single Spore ◽  
First Report

Botrytis cinerea Pers.:Fr., is a necrotrophic fungus with a broad host range that causes gray mold on hundreds of plant species (2). Control of gray mold mainly depends on fungicides, including the dicarboxamide iprodione. Thirty-nine diseased blackberry fruit were collected from four orchards in South Carolina and the sensitivity of single-spore isolates to iprodione was examined by Spiral Plater assays (1) on potato dextrose agar (PDA). Briefly, a 5.3 cm long paper strip containing mycelia was placed along the concentration gradient of the PDA and 50% inhibition (EC50 value) was calculated after 2 days of incubation with the Spiral Gradient Endpoint (SGE) software (Spiral Biotech, Norwood, MA). Each isolate was tested in duplicates. Sensitivity ranged from 0.043 to 2.596 μg/ml, with a maximum resistance factor of 60.4. Isolates with EC50 values greater than 2 μg/ml were found in two orchards. Those isolates represented 40 and 7.1% of the total isolates from each orchard. Two isolates with high (EC50 value of 2.596 μg/ml) and low (EC50 value of 0.062 μg/ml) values were chosen to determine the efficacy of iprodione formulated product Rovral 4 Fl (Bayer CropSciences, Research Triangle Park, NC) on detached apple fruit. Fifteen apples were used for each isolate and experiment. Each fruit was wounded on the surface in three locations with a sterile syringe and inoculated with 15 μl of a spore suspension (106 conidia/ml) at the wounded sites. Rovral was applied at the recommended label rate either 24 h before (protective treatment) or 48 h after inoculation (curative treatment). The experiment was conducted three times. Blackberry fruit were not found suitable for this assay because of persistent contamination problems likely from latent infections of a symptomatic fruit. Disease incidence and lesion diameter were recorded 7 days after incubation. Disease incidence following inoculation of the sensitive and resistant isolates on non-fungicide-treated fruit was 100 and 86.7%, respectively. Disease incidence on fungicide-treated apples was 4.4% for the sensitive isolate and 75.6% for the resistant isolate with corresponding mean lesion areas of 0.36 mm and 9.37 mm, respectively. Both isolates were controlled effectively in protective treatments, however, indicating low levels of resistance. To our knowledge, this is the first report of iprodione resistance in B. cinerea from blackberry or any other field-grown crop in South Carolina. This finding adds to a study from 1999 (3) documenting resistance to the dicarboxamide fungicide vinclozolin in B. cinerea collected from ornamentals in South Carolinian greenhouses and suggests that resistance to iprodione needs to be considered in the design of gray mold control strategies in commercial blackberry orchards. No cross resistance between the phenylpyrrole fludioxonil and iprodione was found. References: (1) H. Forster et al. Phytopathology 94:163, 2004. (2) B. Williamson et al. Mol. Plant Pathol. 8:561. 2007. (3) L. F. Yourman and S. N. Jeffers. Plant Dis. 83:569, 1999.

Sign in / Sign up

Export Citation Format

Share Document