scholarly journals Biosynthesis of gold nanoparticles (AuNPs) and the reducing agents in the process

2021 ◽  
Vol 14 (27) ◽  
pp. 1e-11e
Author(s):  
Blanca Estela Chávez-Sandoval ◽  
Nallely Flores-Mendoza ◽  
Auraamellaly Chávez-Recio ◽  
José Abraham Balderas-López ◽  
Francisco García-Franco
Keyword(s):  
Malic Acid ◽  
Metallic Nanoparticles ◽  
Environmentally Friendly ◽  
Biological Properties ◽  
Reducing Agents ◽  
Biological Synthesis ◽  
Inorganic Synthesis ◽  
General Terms ◽  
Medical Supplies ◽  
20 Nm

Metallic nanoparticles (NPs) are being used mainly because they have excellent physical, chemical and biological properties, intrinsic to their size, therefore there is a boom in the use of these nanoparticles in various fields and recently, due to the pandemic about coronavirus. Copper NPs began to be used for use in medical supplies such as face masks. NPs are normally obtained through inorganic synthesis, however, the methodologies used to obtain them are in general terms expensive and involve the use of hazardous chemicals, which has increased the development of sustainable and environmentally friendly alternatives, as one of the main objectives of nanotechnology. Considering that nanoparticle biosynthesis is of greatest importance since it allowed obtaining organic NPs through an environmentally friendly; quick and inexpensive. In this work, the synthesis and characterization of AuNPs of six different plant extracts that in traditional medicine are used for respiratory diseases care, were performed. These NPs can be used in different fields; even they represent a good option to be added to medical supplies. As the AuNPs obtained from chamomile extract that turned out to be spherical, 20 nm in diameter, and well dispersed, these could be applied orally, as nanocapsules that are easily eliminated from the human body, or by aerosol, as a possible treatment for the pneumonia and SARS-CoV-2, in addition later for other nosocomial diseases. And to answer the question of what or which reducing agents are involved in the process? We proposed that, for biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent, so we performed a synthesis with malic acid and obtained stable NPs. However, we do not dismiss other metabolites enzymes and/or proteins that could be involved in the process.

Green synthesis of silver nanoparticles using sustainable resources and their use as antibacterial agents: A review

2020 ◽  
Vol 13 ◽  
Author(s):  
Kumari Jyoti ◽  
Punyasloka Pattnaik ◽  
Tej Singh
Keyword(s):  
Silver Nanoparticles ◽  
Plant Extracts ◽  
Metallic Nanoparticles ◽  
Cost Effective ◽  
Biological Properties ◽  
Metal Species ◽  
Sustainable Resources ◽  
Research Areas ◽  
Low Toxicity

Background:: Synthesis of metallic nanoparticles has attracted extensive vitality in numerous research areas such as drug delivery, biomedicine, catalysis etc. where continuous efforts are being made by scientists and engineers to investigate new dimensions for both technological and industrial advancements. Amongst numerous metallic nanoparticles, silver nanoparticle (AgNPs) is a novel metal species with low toxicity, higher stability and significant chemical, physical and biological properties. Methods:: In this, various methods for the fabrication of AgNPs are summarized. Importantly, we concentrated on the role of reducing agents of different plants parts, various working conditions such as AgNO3 concentration; ratio of AgNO3/extract; incubation time; centrifugal conditions, size and shapes. Results:: This study suggested that eco-friendly and non toxic biomolecules present in the extracts (e.g. leaf, stem and root) of plants are used as reducing and capping agents for silver nanoparticles fabrication. This method of fabrication of silver nanoparticles using plants extracts is comparatively cost-effective and simple. A silver salt is simply reduced by biomolecules present in the extracts of these plants. In this review, we have emphasized the synthesis and antibacterial potential of silver nanoparticles using various plant extracts. Conclusion:: Fabrication of silver nanoparticles using plant extracts have advantage over the other physical methods, as it is safe, eco-friendly and simple to use. Plants have huge potential for the fabrication of silver nanoparticles of wide potential of applications with desired shape and size.

scholarly journals Effect of Ammonium Nitrate on Nanoparticle Size Reduction

2008 ◽  
Vol 2008 ◽  
pp. 1-4 ◽  
Author(s):  
Kalyana C. Pingali ◽  
Shuguang Deng ◽  
David A. Rockstraw
Keyword(s):  
Ammonium Nitrate ◽  
Metallic Nanoparticles ◽  
Particle Diameter ◽  
Feed Solution ◽  
Pyrolysis Process ◽  
Foaming Agent ◽  
Aerosol Droplet ◽  
Order Of Magnitude ◽  
Spray Pyrolysis Process ◽  
20 Nm

Ammonium nitrate was added to the spraying solution as a foaming agent to reduce the particle size of nanoparticles synthesized in the spray-pyrolysis process. Ammonium nitrate was effective in breaking the aerosol droplet size and generating nanoparticles that were of approximately one order-of-magnitude (from 200 to 20 nm) smaller diameter than those created in the absence of ammonium nitrate in the feed solution. This technique makes it possible to control the particle diameter of metallic nanoparticles below 20 nm.

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Biological Synthesis of Silver Nanoparticles and their Biomedical Activity: A Review

2021 ◽  
Vol 09 ◽  
Author(s):  
Sarvat Zafar ◽  
Aiman Zafar ◽  
Fakhra Jabeen ◽  
Miad Ali Siddiq
Keyword(s):  
Silver Nanoparticles ◽  
Large Scale ◽  
Scale Up ◽  
Cost Effective ◽  
Biological Properties ◽  
Single Step ◽  
Biological Synthesis ◽  
Nanosized Particles ◽  
Environment Friendly ◽  
Physical And Chemical

: Nanotechnology studies the various phenomena of physio-chemical procedures and biological properties for the generation of nanosized particles, and their rising challenges in the various sectors, like medicine, engineering, agriculture, electronic, and environmental studies. The nanosized particles exhibit good anti-microbial, anti-inflammatory, cytotoxic, drug delivery, anti-parasitic, anti-coagulant and catalytic properties because of their unique dimensions with large surface area, chemical stability and higher binding density for the accumulation of various bio-constituents on their surfaces. Biological approaches for the synthesis of silver nanoparticles (AgNPs) have been reviewed because it is an easy and single-step protocol and a viable substitute for the synthetic chemical-based procedures. Physical and chemical approaches for the production of AgNPs are also mentioned herein. Biological synthesis has drawn attention because it is cost-effective, faster, non-pathogenic, environment-friendly, easy to scale-up for large-scale synthesis, and having no demand for usage of high pressure, energy, temperature, or noxious chemical ingredients, and safe for human therapeutic use. Therefore, the collaboration of nanomaterials with bio-green approaches could extend the utilization of biological and cytological properties compatible with AgNPs. In this perspective, there is an immediate need to develop ecofriendly and biocompatible techniques, which strengthen efficacy against microbes and minimize toxicity for human cells. The present study introduces the biological synthesis of silver nanoparticles, and their potential biomedical applications have also been reviewed.

scholarly journals Microbial Transglutaminase as a Tool to Improve the Features of Hydrocolloid-Based Bioplastics

2020 ◽  
Vol 21 (10) ◽  
pp. 3656 ◽  
Author(s):  
C. Valeria L. Giosafatto ◽  
Antonio Fusco ◽  
Asmaa Al-Asmar ◽  
Loredana Mariniello
Keyword(s):  
Value Added ◽  
Environmentally Friendly ◽  
Biological Properties ◽  
Microbial Transglutaminase ◽  
Plant Origin ◽  
Technological Characteristics ◽  
Microbial Enzyme ◽  
The Matrix ◽  
Isopeptide Bonds ◽  
By Products

Several proteins from animal and plant origin act as microbial transglutaminase substrate, a crosslinking enzyme capable of introducing isopeptide bonds into proteins between the aminoacids glutamines and lysines. This feature has been widely exploited to modify the biological properties of many proteins, such as emulsifying, gelling, viscosity, and foaming. Besides, microbial transglutaminase has been used to prepare bioplastics that, because made of renewable molecules, are able to replace the high polluting plastics of petrochemical origin. In fact, most of the time, it has been shown that the microbial enzyme strengthens the matrix of protein-based bioplastics, thus, influencing the technological characteristics of the derived materials. In this review, an overview of the ability of many proteins to behave as good substrates of the enzyme and their ability to give rise to bioplastics with improved properties is presented. Different applications of this enzyme confirm its important role as an additive to recover high value-added protein containing by-products with a double aim (i) to produce environmentally friendly materials and (ii) to find alternative uses of wastes as renewable, cheap, and non-polluting sources. Both principles are in line with the bio-economy paradigm.

scholarly journals Mechanistic Study of Silane Alcoholysis Reactions with Self-Assembled Monolayer-Functionalized Gold Nanoparticle Catalysts

Catalysts ◽  
2020 ◽  
Vol 10 (8) ◽  
pp. 908
Author(s):  
Katsuhiro Isozaki ◽  
Tomoya Taguchi ◽  
Kosuke Ishibashi ◽  
Takafumi Shimoaka ◽  
Wataru Kurashige ◽  
...  
Keyword(s):  
Catalytic Activity ◽  
Metallic Nanoparticles ◽  
Molecular Structures ◽  
Critical Parameters ◽  
Mechanistic Study ◽  
Self Assembled Monolayer ◽  
Mechanistic Investigation ◽  
Self Assembled ◽  
20 Nm ◽  
Silane Alcoholysis

The self-assembled monolayer (SAM)-modified metallic nanoparticles (MNPs) often exhibit improved chemoselectivity in various catalytic reactions by controlling the reactants’ orientations adsorbed in the SAM; however, there have been a few examples showing that the reaction rate, i.e., catalytic activity, is enhanced by the SAM-modification of MNP catalysts. The critical parameters that affect the catalytic activity, such as the supports, nanoparticle size, and molecular structures of the SAM components, remain uninvestigated in these sporadic literature precedents. Here, we report the mechanistic investigation on the effects of those parameters on the catalytic activity of alkanethiolate SAM-functionalized gold nanoparticles (AuNPs) toward silane alcoholysis reactions. The evaluation of the catalytic reaction over two-dimensionally arrayed dodecanethiolate SAM-functionalized AuNPs with different supports revealed the electronic interactions between AuNPs and the supports contributing to the rate enhancement. Additionally, an unprecedented size effect appeared—the AuNP with a 20 nm radius showed higher catalytic activity than those at 10 and 40 nm. Infrared reflection–absorption spectroscopy revealed that the conformational change of alkyl chains of the SAM affects the entrapment of reactants and products inside the SAM, and therefore brings about the acceleration effect. These findings provide a guideline for further applying the SAM-functionalization technique to stereoselective organic transformations with designer MNP catalysts.

Biological Synthesis of Nanosilver by Using Plants

2015 ◽  
Vol 1109 ◽  
pp. 30-34 ◽  
Author(s):  
M.K. Nahar ◽  
Zarina Zakaria ◽  
U. Hashim ◽  
Md Fazlul Bari
Keyword(s):  
Silver Nanoparticles ◽  
Green Chemistry ◽  
Metallic Nanoparticles ◽  
Large Scale ◽  
Cost Effective ◽  
High Energy ◽  
Vital Role ◽  
Environmentally Benign ◽  
Biological Synthesis ◽  
Promising Area

Nanotechnology is a most promising area that is increasing day by day and play a vital role in environments, biotechnological and biomedical fields. In recent years, the development of effective green chemistry methods for synthesis of various metal nanoparticles has become a main focus of researchers. They have investigated to find out a sustainable technique for production of well-characterized nanoparticles. A variety of chemical and physical methods have been exploited in the synthesis of silver nanoparticles (AgNPs) and these procedures remain expensive, high energy consumption and involve the use of hazardous chemicals. Therefore, there is an essential need to develop environmentally benign and sustainable procedures for synthesis of metallic nanoparticles. Increasing awareness of green chemistry and biological processes has need to develop a rapid, simple, cost-effective and eco-friendly methods. One of the most considered methods is production of nanosilver using plants and plant-derived materials which is the best candidates and suitable for large-scale biosynthesis of silver nanoparticles. Eco-friendly bio-organisms in plant extracts contain proteins, which act as both capping and reducing agents forming of stable and shape-controlled AgNPs. This review describes the recent advancements in the green synthesis of silver nanoparticles by using plants.

scholarly journals Chitosan: An Overview of Its Properties and Applications

Polymers ◽  
2021 ◽  
Vol 13 (19) ◽  
pp. 3256
Author(s):  
Inmaculada Aranaz ◽  
Andrés R. Alcántara ◽  
Maria Concepción Civera ◽  
Concepción Arias ◽  
Begoña Elorza ◽  
...  
Keyword(s):  
Metallic Nanoparticles ◽  
Biological Properties ◽  
Technological Properties ◽  
Natural Origin ◽  
Technological Performance ◽  
Poor Solubility ◽  
Polymer Properties ◽  
Monomer Distribution ◽  
Number Of Publications ◽  
The Relationship

Chitosan has garnered much interest due to its properties and possible applications. Every year the number of publications and patents based on this polymer increase. Chitosan exhibits poor solubility in neutral and basic media, limiting its use in such conditions. Another serious obstacle is directly related to its natural origin. Chitosan is not a single polymer with a defined structure but a family of molecules with differences in their composition, size, and monomer distribution. These properties have a fundamental effect on the biological and technological performance of the polymer. Moreover, some of the biological properties claimed are discrete. In this review, we discuss how chitosan chemistry can solve the problems related to its poor solubility and can boost the polymer properties. We focus on some of the main biological properties of chitosan and the relationship with the physicochemical properties of the polymer. Then, we review two polymer applications related to green processes: the use of chitosan in the green synthesis of metallic nanoparticles and its use as support for biocatalysts. Finally, we briefly describe how making use of the technological properties of chitosan makes it possible to develop a variety of systems for drug delivery.

scholarly journals Biogenic Synthesis of Zinc Oxide (ZnO) Nanoparticles Using a Fungus (Aspargillus niger) and Their Characterization

2019 ◽  
Vol 11 (2) ◽  
pp. 119 ◽  
Author(s):  
Aisha Shamim ◽  
Tariq Mahmood ◽  
Monis Bin Abid
Keyword(s):  
Zinc Oxide ◽  
Zno Nanoparticles ◽  
Metallic Nanoparticles ◽  
Physical Method ◽  
Biological Synthesis ◽  
Zno Nps ◽  
Biogenic Synthesis ◽  
Time Saving ◽  
X Ray ◽  
Stabilizing Agents

Nanoparticles are ultrafine structures with dimensions less than 100 nm. Nanoparticles have diverse applications. There are three important methods of fabrication of nanoparticles namely physical, chemical and biological methods. Physical method is a top down strategy for the fabrication of nanoparticles. It is energy intensive and time consuming. A chemical method is simple, but is expensive and requires expensive chemicals with high purity and also involves hazards of contaminations. Biological synthesis is very simple, cheap and environment friendly, requiring no expensive chemicals, temperature and is time saving. Plants and microorganisms are commonly used in this method. These are available everywhere. In the present work we synthesized Zinc Oxide (ZnO) nanoparticles by biological method using Aspargillus niger and zinc chloride (ZnCl2) as precursors. Biogenic synthesis of metallic nanoparticles by fungi is a safe and economical process because of formation of stable and small sized nanoparticles. Fungal biomass secretes proteins which act as reducing and stabilizing agents. The synthesized nanoparticles were characterized by XRD (X-Ray Diffraction), SEM (Scanning Electron Microscopy), UV-Vis (Ultraviolet, Visible) and EDX (Energy Dispersive X-Ray) techniques. Their size was in nm range and morphology of synthesized ZnO NPs was hexagonal. The ZnO nanoparticles are one of the most versatile materials and are used in cosmetics and in Bioenergy production, as a catalyst and as antibacterial material.

Sign in / Sign up

Export Citation Format

Share Document