The Impact of Malting on Nutritional Composition of Foxtail Millet, Wheat and Chickpea

2015 ◽  
Vol 05 (05) ◽  
Author(s):  
Laxmi G Chaturvedi N
Keyword(s):  
Foxtail Millet ◽  
Nutritional Composition ◽  
The Impact

scholarly journals Use of New BTH Derivative as Supplement or Substitute of Standard Fungicidal Program in Strawberry Cultivation

Agronomy ◽  
2021 ◽  
Vol 11 (6) ◽  
pp. 1031
Author(s):  
Maciej Spychalski ◽  
Rafal Kukawka ◽  
Włodzimierz Krzesiński ◽  
Tomasz Spiżewski ◽  
Monika Michalecka ◽  
...  
Keyword(s):  
Plant Resistance ◽  
Positive Impact ◽  
Quality Parameters ◽  
Nutritional Composition ◽  
Matter Content ◽  
Dry Matter Content ◽  
Yield And Quality ◽  
Amide Derivative ◽  
Combined Use ◽  
The Impact

Triggering the plant resistance induction phenomenon by chemical compounds, for example acibenzolar-S-methyl ester, has been known and described in scientific literature. Other benzothadiazole derivatives have been also described; however, their properties have not been sufficiently studied. The tested substance, N-methyl-N-methoxyamide-7-carboxybenzo(1.2.3)thiadiazole (BTHWA), is an amide derivative of benzothiadiazole, showing a stimulating effect on plant growth, apart from its plant resistance inducing activity. This article presents the impact of BTHWA, used solo and in the program with fungicides, on the strawberry plants development, fruits health, yield, and quality parameters of the crop. The results show that the combined use of BTHWA and fungicides had a positive impact on the plants health and fruit health and nutraceutical and nutritional composition of compounds when compared to the results obtained when strawberries were treated only with the BTHWA or the fungicide. As a result of BTHWA use, the partitioning of assimilates has changed, which directly translated into the results of the conducted experiments. A reduction in the respiration of the fruit during storage was also observed, possibly due to a reduced disease infestation and a lower dry matter content in the fruit. A correlation between the parameters determined during the experiment was found. The BTHWA mode of action was evidenced to be beneficial to strawberry plants and fruit.

scholarly journals Modelling the dietary impact of health-related claims on food labels in the UK

2020 ◽  
Vol 79 (OCE2) ◽  
Author(s):  
Asha Kaur ◽  
Peter Scarborough ◽  
Mike Rayner
Keyword(s):  
Nutritional Quality ◽  
Meta Analysis ◽  
Saturated Fat ◽  
Nutritional Composition ◽  
Health Claims ◽  
Baseline Scenario ◽  
Health Related ◽  
Mathematical Equations ◽  
The Impact

AbstractHealth-related claims (HRCs) are statements found on food packets that convey the nutritional quality of a food (nutrition claims) and/or its impact on a health outcome (health claims). Foods carrying HRCs have a slightly improved nutritional profile than foods without HRCs, however, it's unclear whether this translates into dietary improvements. We conducted a modelling study to measure the effect of HRCs on diet. As HRCs are already present on foods it is assumed that any impact that they have upon diet are already in effect. We modelled the impact on food purchases of removing HRCs, by assuming that the sales boost they receive is neutralised. These results can be inverted to estimate the current dietary impact of HRCs. Using the Living Costs Food (LCF) survey data, we calculate the average purchases and nutrient intake per person, per day. The LCF data is divided into sales of products with HRCs and sales of products without HRCs through solving mathematical equations combining LCF sales data with odds ratios from a meta-analysis examining the impact of HRCs on choices and data from a survey of foods examining the prevalence of HRCs and the nutritional quality of foods that carry them so that the sum of the sales of products with HRCs and without HRCs is equal to the total sales of products. Similarly, mathematical equations are solved that combine nutritional composition data with the sales of foods carrying and not carrying HRCs. In the baseline scenario foods carrying HRCs made-up 37% of the total purchases, and contributed 29% (559kcal) of the total kcals purchased (1907kcal). When HRCs are removed from foods there is an average increase of 18kcal/d (95% Uncertainty Intervals [UI] -15, 52), + 2g/d increase in total fat (95% UI -1, 4) and saturated fat (95% UI 1, 3), smaller changes are seen for protein (+ 0.5g/d, 95% UI -1, 2), total sugar (+ 0.5g/d, 95% UI -4, 7) and carbohydrate (-0.5g/d, 95% UI -5, 7). There is reduction in the amount of fruit (-11g/d, 95% UI -34, 26) but an increase in vegetables (+ 6g/d, 95% UI -6, 19). These results should be interpreted with caution due to the large uncertainty intervals. When HRCs are removed, we see a small deterioration in the quality of the average diet. If we invert these findings we can assume HRCs currently have a positive, albeit small, impact on diet.

scholarly journals PSV-30 A nutritional survey of commercially available grass-finished beef

2019 ◽  
Vol 97 (Supplement_3) ◽  
pp. 341-342
Author(s):  
Jason Rowntree ◽  
Sara Bronkema ◽  
Raghav Jain ◽  
Jeannine Schweihofer ◽  
Chad Bitler ◽  
...  
Keyword(s):  
Production Systems ◽  
Production Capacity ◽  
The United States ◽  
Nutritional Composition ◽  
Gas Chromatography Mass Spectrometry ◽  
Omega 3 ◽  
Forage Crops ◽  
Carotene Content ◽  
Finishing Diets ◽  
The Impact

Abstract Consumer interest in the source of their food, its environmental footprint, and the impact of diet on health has supported the growth of the grass-finished beef (GFB) industry. Studies have concluded that GFB has distinct nutritional differences from conventionally-finished beef. As the GFB industry continues to expand, it is vital to continue to explore the nutritional complexities and variation in the product. To achieve this, a survey of grass-finishing production systems throughout the United States was conducted, and beef finished on the participating farms was analyzed for its nutritional composition, including fatty acid (FA), mineral and fat-soluble vitamin contents. Samples were analyzed from 12 producers and annual production capacity of farms ranged from 25 to 5,000 cattle, with a mean age of cattle at harvest of 26.8 ± 2.30 mo. An array of finishing diets included grazing exclusively in perennial pasture, incorporating annual forage crops, and feeding a variety of harvested forages with supplementation of non-starch feed byproducts. Beef muscle tissue FA content was analyzed by gas chromatography-mass spectrometry (GC–MS). The mean ratio of omega-6 (n-6) to omega-3 (n-3) FA in samples varied significantly by producer, ranging from 1.80 to 28.3 (P < 0.0001), with an overall sample set median of 4.10. A selection of minerals including iron, magnesium, and potassium were analyzed by ICP emission spectroscopy and mineral content significantly differed by producer for all minerals (P < 0.001). Mean α-tocopherol and β-carotene content was 610.6 μg/100 g beef and 32.2 μg/100 g, respectively. The amount of these antioxidants also varied between producers (P < 0.0001), but tended to be greater in beef finished solely on fresh forages. This survey indicates that commercially available GFB can vary in nutritional composition due to the diverse practices used to grass-finish cattle.

scholarly journals School meals in French secondary state schools: do national recommendations lead to healthier nutrition on offer?

2011 ◽  
Vol 107 (3) ◽  
pp. 416-427 ◽  
Author(s):  
Mélanie Bertin ◽  
Lionel Lafay ◽  
Gloria Calamassi-Tran ◽  
Jean-Luc Volatier ◽  
Carine Dubuisson
Keyword(s):  
Secondary Schools ◽  
Vitamin C ◽  
Food Group ◽  
Food Composition ◽  
Nutritional Composition ◽  
Ministry Of Education ◽  
School Meals ◽  
School Lunches ◽  
Group Frequency ◽  
The Impact

To improve the dietary offering in schools, the French authorities published recommendations on nutrition in 1999, which were then revised in 2007. The aim of the present study was to assess the nutritional offering in secondary school meals and the extent to which the recommendations promote balanced nutritional offerings. In 2005, a national survey was conducted on a representative sample of secondary schools, either administrated by the Ministry of Education (ES) or the Ministry of Agriculture (AS). Information on school-catering organisation and twenty consecutive meals was collected from each of the 707 secondary schools surveyed. Nutritional composition was estimated according to the French food composition database. Univariate and multivariate analyses were used to investigate the impact of food-group frequency guidelines (FFG) on nutritional offering. It was found that 15 and 26 % of ES and AS schools, respectively, had high compliance with the FFG, at lunch. Macronutrient content was unbalanced in ES school lunches in which 42·8 % lipids, 21·5 % proteins and 35·7 % carbohydrates contributed to the energy. Nevertheless, proper offerings in Fe, Ca and vitamin C content were observed. In addition, a lower offering in lipids and a higher offering in proteins, Ca, vitamin C and Fe were found when the FFG were applied (P < 0·001). Similar results were found for AS schools. This paper confirms the effectiveness of FFG in providing nutritionally balanced school meals. However, others measures such as nutrition promotion and actions to improve children's food habits have to be introduced to make the recommendations more effective and easier to understand.

Maintaining the appeal of Australian lamb to the modern consumer

2018 ◽  
Vol 58 (8) ◽  
pp. 1392 ◽  
Author(s):  
S. M. Fowler ◽  
J. M. Hoban ◽  
G. Melville ◽  
D. W. Pethick ◽  
S. Morris ◽  
...  
Keyword(s):  
Supply Chain ◽  
Management Practices ◽  
Nutritive Value ◽  
Consumer Preferences ◽  
Value Added ◽  
Nutritional Composition ◽  
Carcass Weight ◽  
Retail Cuts ◽  
On Farm ◽  
The Impact

Aligning the production of lamb cuts with consumer preferences is an ongoing challenge for the Australian lamb supply chain. In recent decades, genetic and on-farm management practices have improved, while the demographics of consumers and their consumption patterns have changed. This has resulted in larger traditional lamb cuts, which have less appeal to modern consumers. Therefore, research has been conducted to determine the potential to fabricate new value-added lamb cuts from heavier carcasses, determine consumer preferences for lamb roasts, investigate the impact of increasing carcass weight and fat depths on the production of value-added retail cuts and determine the nutritional composition of these cuts. In an effort to address these issues, a new value-added cut, the compact shoulder roast, was developed from the forequarter of the carcass to provide an option for retailers processing heavier lamb carcasses. A subsequent survey of consumer preferences highlighted that preferences for roast weight and size were affected by frequency of consumption, with daily consumers preferring the heaviest roasts and younger consumers preferring lighter roasts, implying the need for further fabrication, such as that required for the compact shoulder roast. However, the time taken to fabricate these value-added cuts increases with each kilo increase in carcass weight and decreasing saleable meat yield of lamb carcasses results as the degree of value-adding increases, indicating that a higher average price per kilo is required at retail. Subsequently, value-added cuts will need to be marketed on the basis of other product qualities such as nutritive value. However, profiling of lamb cuts has also shown that there is little data on the nutritive value of a range of lamb cuts, apart from the loin, so work has been undertaken to address this deficiency using grass-fed lamb through a major supply chain.

scholarly journals First Report of Rice stripe virus of Proso Millet in Korea

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 150-150 ◽  
Author(s):  
Y. Yoon ◽  
J. Jung ◽  
B. Lee ◽  
Y. Lee ◽  
J. Lee ◽  
...  
Keyword(s):  
Coat Protein ◽  
South Korea ◽  
Foxtail Millet ◽  
Rice Stripe Virus ◽  
Management Options ◽  
First Report ◽  
Proso Millet ◽  
Cereal Grain ◽  
Yellow Stripe ◽  
The Impact

Rice stripe virus (RSV; genus Tenuivirus) is a serious threat to rice production in Korea (2). In 1965, a disease outbreak was observed on rice in South Korea, with plants showing yellow stripe symptoms (2). Reoccurrence of RSV in rice was observed again in 1980 in Gyeonggi and Chungcheong. In 2001, RSV was estimated to be infecting approximately 4,663 ha of rice in the provinces of Gyeonggi and Gangwha and approximately 5,000 ha of riceland in the provinces of Buan and, Seocheon (3). Proso millet (Panicum miliaceum L.) is grown as a cereal grain crop and used mainly for human food in South Korea (1). In June 2009, proso millet plants that displayed yellow stripe symptoms were collected at Sinjeon-Myeon, Gangjin-Gun, and Jeollanam-do provinces, where an outbreak of RSV in rice was reported. Diseased plants tested positive to RSV with an ELISA Kit (KisanBio, Seoul, Korea). Total RNA was extracted from leaf tissue with an RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). RSV coat protein specific-primers were produced (5′ TGTGGAACATAGTCCCACAGTAAGT 3′(upstream), 5′ CTAAGCCGCAACCATTCCTCCAGT 3′(downstream). Reverse transcription-PCR confirmed the presence of a 494-bp product as predicted for the presence of RSV. The coat protein of RSV isolates collected from proso millet, rice, and foxtail millet in the same area was also sequenced. Results confirmed that phylogenetic relationships were of high homology: 98.9% between RSV isolates from rice and foxtail millet, 99.2% between isolates from rice (GenBank Accession No. JN245626) and proso millet (GenBank Accession No. JN245627); 99.6% between rice and foxtail millet (GenBank Accession No. JN245628); and 99.6% between foxtail millet and proso millet. In addition, sequence comparisons showed 96 to 99% identity with known RSV sequences available in GenBank (Accession No. X53563) (4). To our knowledge, this is the first report of RSV of proso millet in South Korea. The finding of this disease confirms further spread of the virus within the northern part of South Korea and the need for research to develop more effective management options to reduce the impact of RSV in proso millet. References: (1) Y. Y. Choi et al. Biosci. Biotechnol. Biochem. 69:31, 2005. (2) B. C. Lee et al. Res. Plant Dis. 10:30, 2004. (3) B. C. Lee et al. Res. Plant Dis. 14:210, 2008. (4) Y. Zhu. J. Gen. Virol. 72:763, 1991.

scholarly journals Optimizing the Nutritional Composition of a Meat Substitute Intended to Replace Meat in Observed Diet Results in Marked Improvement of the Diet Quality of French Adults

2021 ◽  
Vol 5 (Supplement_2) ◽  
pp. 1089-1089
Author(s):  
Marion Salomé ◽  
Hélène Fouillet ◽  
Marie-Charlotte Nicaud ◽  
Alison Dussiot ◽  
Emmanuelle Kesse-Guyot ◽  
...  
Keyword(s):  
Diet Quality ◽  
Nutrient Intake ◽  
Adult Population ◽  
Linear Optimization ◽  
Nutritional Composition ◽  
Alpha Linolenic Acid ◽  
Meat Substitute ◽  
Dried Shiitake Mushroom ◽  
The Impact

Abstract Objectives While consumers’ demand is growing, meat substitutes have much varied composition, raising questions about their nutritional interest. We aimed to identify the composition of a meat substitute that would best improve diet quality, and analyze the impact on nutrient adequacy. Methods We aimed at maximizing the overall diet quality of an average individual representing the nutrient intake of the French adult population (INCA3, n = 1125) by modeling the composition of a meat substitute intended to replace meat, using non-linear optimization (using SAS, proc optmodel). The diet quality was assessed using the PANDiet scoring system, which assesses the probability of adequate nutrient intake. Nutritional constraints were applied in order to not increase the risk of overt deficiency for 12 nutrients. A list of 159 ingredients was used to compose the meat replacer and technological constraints were defined so as to take into account the feasibility of the formulation. The impacts on diet quality of the modelled meat substitute were analyzed and compared with those of 43 meat substitutes on the market. Results The optimized meat substitute was composed of 13 ingredients (such as coco bean, yellow sweet pepper, rapeseed oil, dried shiitake mushroom, wheat bran and thyme) and this formulation proved to be relatively robust to variations in the model constraints, as shown by a sensitivity analysis. Meat substitution with this optimized meat substitute largely increased the PANDiet, by 5.5 points above its initial value before substitution (73.7/100). In particular, it led to better adequacies for nutrients that are currently insufficiently consumed (e.g., alpha-linolenic acid, fiber, linoleic acid). It also allowed to compensate for loss of some nutrients partly provided by meat (e.g., vitamin B6, potassium and, to a certain extent, bioavailable iron), but was not sufficient to compensate for bioavailable zinc and vitamin B12. The optimized meat substitute proved to be dramatically more nutritionally efficient than the available meat substitutes, whose individual impact on the PANDiet ranged from −3.1 to +1.5 points. Conclusions We proved that it is possible to select appropriate ingredients resulting in a meat substitute that could be a fairly good nutritional lever when substituting meat. Funding Sources Partly funded by a PhD fellowship from Terres Univia.

scholarly journals Estimated Intakes of Nutrients and Polyphenols in Participants Completing the MaPLE Randomised Controlled Trial and Its Relevance for the Future Development of Dietary Guidelines for the Older Subjects

Nutrients ◽  
2020 ◽  
Vol 12 (8) ◽  
pp. 2458 ◽  
Author(s):  
Daniela Martini ◽  
Stefano Bernardi ◽  
Cristian Del Bo’ ◽  
Nicole Hidalgo Liberona ◽  
Raul Zamora-Ros ◽  
...  
Keyword(s):  
Controlled Trial ◽  
Control Diet ◽  
Target Population ◽  
Nutritional Composition ◽  
Dietary Guidelines ◽  
Age Related ◽  
Older Subjects ◽  
Polyphenol Intake ◽  
Randomised Controlled ◽  
The Impact

The evaluation of food intake in older subjects is crucial in order to be able to verify adherence to nutritional recommendations. In this context, estimation of the intake of specific dietary bioactives, such as polyphenols, although particularly challenging, is necessary to plan possible intervention strategies to increase their intake. The aims of the present study were to: (i) evaluate the nutritional composition of dietary menus provided in a residential care setting; (ii) estimate the actual intake of nutrients and polyphenols in a group of older subjects participating in the MaPLE study; and (iii) investigate the impact of an eight-week polyphenol-rich dietary pattern, compared to an eight-week control diet, on overall nutrient and polyphenol intake in older participants. The menus served to the participants provided ~770 mg per day of total polyphenols on average with small variations between seasons. The analysis of real consumption, measured using weighed food diaries, demonstrated a lower nutrient (~20%) and polyphenol intake (~15%) compared to that provided by the menus. The feasibility of dietary patterns that enable an increase in polyphenol intake with putative health benefits for age-related conditions is discussed, with a perspective to developing dietary guidelines for this target population.

scholarly journals Cooking of Artemide Black Rice: Impact on Proximate Composition and Phenolic Compounds

Foods ◽  
2021 ◽  
Vol 10 (4) ◽  
pp. 824
Author(s):  
Antonio Colasanto ◽  
Fabiano Travaglia ◽  
Matteo Bordiga ◽  
Stefania Monteduro ◽  
Marco Arlorio ◽  
...  
Keyword(s):  
Proximate Composition ◽  
Protocatechuic Acid ◽  
Nutritional Composition ◽  
Cooking Methods ◽  
Anthocyanin Content ◽  
Black Rice ◽  
Total Polyphenols ◽  
Total Anthocyanin ◽  
Total Anthocyanin Content ◽  
The Impact

The consumption of black rice has grown in recent years due to its particular organoleptic properties and high content of antioxidant polyphenols, which make it a sort of natural functional food. However, heat treatment applied during cooking can influence the content and the composition of antioxidant components, particularly anthocyanins, the main compounds of black rice, responsible for its color. The aim of this work was to evaluate the impact of different cooking techniques (boiling, microwaves oven, under pressure pot and risotto preparation) on the chemical and nutritional composition of the Italian Artemide black rice. Different cooking methods had significant and different impact on rice composition. Proximate composition was not affected by cooking, except for moisture, which increased, and fiber content, which decreased. Total polyphenols, total anthocyanin content, and antioxidant capacity were reduced; moreover, anthocyanins and phenolic acids determined by HPLC-DAD generally decreased, with the only exception of protocatechuic acid. The risotto preparation was the most useful cooking technique to preserve anthocyanins and antioxidant activity. Our results demonstrated the importance to study cooking methods and to evaluate their impact on rice characteristics, in order to preserve its nutritional and beneficial properties.

Sign in / Sign up

Export Citation Format

Share Document