scholarly journals Effect ofGloriosa superbaandCatharanthus roseusExtracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

2014 ◽  
Vol 2014 ◽  
pp. 1-11 ◽  
Author(s):  
Nattaporn Pattarachotanant ◽  
Varaporn Rakkhitawatthana ◽  
Tewin Tencomnao
Keyword(s):  
Skin Diseases ◽  
Human Keratinocytes ◽  
Dependent Manner ◽  
Gloriosa Superba ◽  
Experimental Approaches ◽  
Ifn Γ ◽  
Keratin 17 ◽  
Ethanol Extracts ◽  
Dose Dependent ◽  
Stat Pathway

Gloriosa superbaandCatharanthus roseusare useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived fromG. superbaleaves andC. roseusstems on the expression of psoriatic marker, keratin 17 (K17), was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3). The inhibitory activity ofG. superbaextract was more potent than that ofC. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts ofG. superbaandC. roseusmay be developed as alternative therapies for psoriasis.

Pharmacognostical Standardization and Pharmacological Potential of Elaeocarpus ganitrus Leaves as an Antiulcer Agent

2018 ◽  
Vol 11 (4) ◽  
pp. 4162-4169
Author(s):  
Mayank Kulshreshtha ◽  
Manjul Pratap Singh
Keyword(s):  
Skin Diseases ◽  
Scientific Data ◽  
Water Soluble ◽  
Histopathological Analysis ◽  
Phytochemical Analysis ◽  
Dependent Manner ◽  
Soluble Extract ◽  
Biochemical Studies ◽  
Pharmacological Potential ◽  
Dose Dependent

Elaeocarpus ganitrus Roxb, (E. ganitrus) known as Rudraksha belongs to family- Eleocarpaceae. It has a reflecting position in Hinduism and Ayurveda whereas traditionally it has mentioned to cure various health problems like fever, skin diseases, mental problems, wound healing etc. The present study was designed to study the microscopic and macroscopic analysis, physiochemical parameters, quantitative microscopy, phytochemical screening of E. ganitrus leaves as per WHO guidelines and evaluate the antiulcer potential of aqueous extract of E. ganitrus (AEEG) and ethanolic extract of E. ganitrus (EEEG) at the doses of 200 mg/kg and 400 mg/kg using pylorus ligation induced ulcers model, biochemical parameters. Hepatic, cardiac, hematological parameters have also done to find out the effect of different extracts on other major organs. Microscopic analysis proved the presence of covering trichomes, upper epidermis, lower epidermis, stomata, phloem, xylem etc. Ash value, water soluble ash, acid soluble ash, water soluble extract, alcohol soluble extract, loss on drying, swelling index, foaming index found to be 4.3 ± 0.52, 0.2 ± 0.33, 2.0 ± 0.2, 13.7 ± 0.25, 12.5 ± 0.55, 9.8 ± 0.23, 3.6 ± 0.04, more than 100. Different quantitative parameters were found out. Phytochemical analysis of different extracts showed the presence of various primary and secondary metabolite like alkaloids, glycosides, tannin, phenolic compounds etc. Pharmacological potential showed that extracts treated, and sucralfate treated groups showed significantly decreases in ulcer index in all above-mentioned models, biochemical studies clearly showed significant decreases in volume, pH, free acidity, total acidity of gastric content and increases in gastric mucus parameters like protein, total hexoses, hexosamine, fucose, sialic acid and DNA level. The level of antioxidant enzymes like LPO (Lipid peroxidation), SOD (Superoxide dimutase) were decreased and CAT (Catalase) level was increased. Level of PC (Plasma corticosterone) was decreased. Hematological, hepatic, cardiac parameters found to be normal during extracts treatment. Histopathological analysis clearly supports the biochemical studies at various doses and it was found to be effective in dose dependent manner. The obtained scientific data may be helpful to prepare the monograph of the plant and E. ganitrus has antiulcer potential in a dose dependent. Detailed study needed for better exposure of plant.

scholarly journals Streptococcus pneumoniae Autolysis Prevents Phagocytosis and Production of Phagocyte-Activating Cytokines

2009 ◽  
Vol 77 (9) ◽  
pp. 3826-3837 ◽  
Author(s):  
Anna Martner ◽  
Susann Skovbjerg ◽  
James C. Paton ◽  
Agnes E. Wold
Keyword(s):  
Streptococcus Pneumoniae ◽  
Mononuclear Cells ◽  
Human Peripheral Blood ◽  
Interleukin 12 ◽  
Dependent Manner ◽  
Peripheral Blood Mononuclear ◽  
Exact Function ◽  
Ifn Γ ◽  
Dose Dependent

ABSTRACT Streptococcus pneumoniae is a major pathogen in humans. The pathogenicity of this organism is related to its many virulence factors, the most important of which is the thick pneumococcal capsule that minimizes phagocytosis. Another virulence-associated trait is the tendency of this bacterium to undergo autolysis in stationary phase through activation of the cell wall-bound amidase LytA, which breaks down peptidoglycan. The exact function of autolysis in pneumococcal pathogenesis is, however, unclear. Here, we show the selective and specific inefficiency of wild-type S. pneumoniae for inducing production of phagocyte-activating cytokines in human peripheral blood mononuclear cells (PBMC). Indeed, clinical pneumococcal strains induced production of 30-fold less tumor necrosis factor (TNF), 15-fold less gamma interferon (IFN-γ), and only negligible amounts of interleukin-12 (IL-12) compared with other closely related Streptococcus species, whereas the levels of induction of IL-6, IL-8, and IL-10 production were similar. If pneumococcal LytA was inactivated by mutation or by culture in a medium containing excess choline, the pneumococci induced production of significantly more TNF, IFN-γ, and IL-12 in PBMC, whereas the production of IL-6, IL-8, and IL-10 was unaffected. Further, adding autolyzed pneumococci to intact bacteria inhibited production of TNF, IFN-γ, and IL-12 in a dose-dependent manner but did not inhibit production of IL-6, IL-8, and IL-10 in response to the intact bacteria. Fragments from autolyzed bacteria inhibited phagocytosis of intact bacteria and reduced the in vitro elimination of pneumococci from human blood. Our results suggest that fragments generated by autolysis of bacteria with reduced viability interfere with phagocyte-mediated elimination of live pneumococci.

Lenalidomide Strongly Enhances Natural Killer (NK) Cell Mediated Antibody-Dependent Cellular Cytotoxicity (ADCC) of Rituximab Treated Non-Hodkin’s Lymphoma Cell Lines In Vitro.

Blood ◽  
2006 ◽  
Vol 108 (11) ◽  
pp. 3714-3714 ◽  
Author(s):  
Lei Wu ◽  
Peter Schafer ◽  
George Muller ◽  
David Stirling ◽  
J. Blake Bartlett
Keyword(s):  
Nk Cells ◽  
Tumor Cells ◽  
Cell Lines ◽  
Nk Cell ◽  
Dependent Manner ◽  
Activation Markers ◽  
Early Results ◽  
Ifn Γ ◽  
Dose Dependent

Abstract Lenalidomide (Revlimid® is approved for the treatment of transfusion-dependent patients with anemia due to low- or intermediate-1-risk MDS associated with a del 5q cytogenetic abnormality with or without additional cytogenetic abnormalities, and in combination with dexamethasone is for the treatment of multiple myeloma patients who have received at least one prior therapy. Encouraging early results suggest a potential for clinical efficacy in B cell non-Hodgkin’s lymphoma (NHL). Potential mechanisms of action include anti-angiogenic, anti-proliferative and immunomodulatory activities. Lenalidomide has been shown to enhance Th1-type cytokines and T cell and NK cell activation markers in patients with advanced cancers. Furthermore, lenalidomide has been shown to enhance rituximab-mediated protection in a SCID mouse lymphoma model in vivo. We have utilized an in vitro ADCC system to assess the ability of lenalidomide to directly enhance human NK cell function in response to therapeutic antibodies, such as rituximab (chimeric anti-CD20 mAb). Isolated NK cells produced little or no IFN-γ in response to IgG and/or IL-2 or IL-12. However, pre-treatment of NK cells with lenalidomide greatly enhanced IFN-γ production by NK cells in a dose-dependent manner. In a functional ADCC assay, NHL cell lines (Namalwa, Farage & Raji) were pre-coated with rituximab and exposed to NK cells pre-treated with lenalidomide in the presence of either exogenous IL-2 or IL-12. After 4 hours in culture the viability of the tumor cells was assessed. Lenalidomide consistently and synergistically increased the killing of tumor cells in a dose-dependent manner and up to >4-fold compared to rituximab alone. Rituximab alone had only a small effect in this model and there was no killing of cells in the absence of rituximab. The presence of either exogenous IL-2 or IL-12 was required to see enhanced killing by lenalidomide. In cancer patients lenalidomide has been shown to increase serum IL-12 levels and is also known to induce IL-2 production by T cells in vitro. Potential mechanisms for enhanced ADCC include increased signaling through NK FCγ receptors and/or IL-2 or IL-12 receptors. However, we found that these receptors are unaffected by lenalidomide, although downstream effects on NK signaling pathways are likely and are being actively investigated. In conclusion, we have shown that lenalidomide strongly enhances the ability of rituximab to induce ADCC mediated killing of NHL cells in vitro. This provides a strong rationale for combination of these drugs in patients with NHL and CLL.

scholarly journals Interferons and Ribavirin Effectively Inhibit Norwalk Virus Replication in Replicon-Bearing Cells

2007 ◽  
Vol 81 (22) ◽  
pp. 12111-12118 ◽  
Author(s):  
Kyeong-Ok Chang ◽  
David W. George
Keyword(s):  
Mutation Rates ◽  
Sequencing Analysis ◽  
Dependent Manner ◽  
Cell Culture System ◽  
Norwalk Virus ◽  
Antiviral Effects ◽  
A Cell ◽  
Ifn Γ ◽  
Dose Dependent ◽  
Excellent Tool

ABSTRACT The development of effective therapies for noroviral gastroenteritis has been hampered by the absence of a cell culture system. Recently, we reported the generation of Norwalk virus (NV) replicon-bearing cells in BHK21 and Huh-7 cells and demonstrated that alpha interferon (IFN-α) effectively inhibited the replication of NV in these cells. In continuing studies for screening potential antinoroviral agents, we tested IFN-γ and ribavirin for their effects on NV replication in the cells. Like IFN-α, IFN-γ inhibited the replication of NV in the replicon-bearing cells, showing the reduction of the NV genome and proteins in a dose-dependent manner. The effective dose for reducing 50% (ED50) of the NV genome and protein was calculated to be approximately 40 units/ml. When ribavirin was applied to the cells, it effectively reduced the NV genome and protein with the ED50 calculated as approximately 40 μM. The combination of IFN-α and ribavirin showed additive effects on the inhibition of NV replication. With the addition of guanosine to the ribavirin treatment, moderately reversed antiviral effects were observed, suggesting that the ribavirin effect may be associated with the depletion of GTP in the cells. Sequencing analysis of the conserved polymerase regions of NV in the ribavirin-treated (100 μM) and nontreated groups showed that the mutation rates were similar and indicated that ribavirin did not induce catastrophic mutations. The NV replicon-bearing cells provide an excellent tool for screening potential antinoroviral agents, and our results indicated that IFNs and ribavirin may be good therapeutic options for noroviral gastroenteritis.

scholarly journals Anti-Nosemosis Activity of Aster scaber and Artemisia dubia Aqueous Extracts

2018 ◽  
Vol 62 (1) ◽  
pp. 27-38
Author(s):  
Jae Kwon Lee ◽  
Jeong Hwa Kim ◽  
Mina Jo ◽  
Balamurugan Rangachari ◽  
Jin Kyu Park
Keyword(s):  
Optimal Dose ◽  
Dependent Manner ◽  
Aqueous Extracts ◽  
Active Components ◽  
Aqueous Fraction ◽  
Ethanol Extracts ◽  
Artemisia Dubia ◽  
Dose Dependent

Abstract In our previous study, we demonstrated that the ethanol extracts of Artemisia dubia (A. dubia) and Aster scaber (A. scaber) have anti-nosemosis activity. In our present study, we intend to establish the anti-nosemosis activity of aqueous, ethyl acetate (EA), and butanol (BuOH) extracts of A. dubia and A. scaber. In order to determine the optimal dose, we performed both in vitro and in vivo toxicity for all the extracts and also carried out anti-nosemosis experiments. Although all of the extracts (aqueous, EA, and BuOH) showed in vitro and in vivo anti-nosemosis activity in a dose-dependent manner, the aqueous extracts of A. dubia and A. scaber showed more potent anti-nosemosis activity than the EA and BuOH extracts. Moreover, an aqueous extract of A. dubia + A. scaber demonstrated stronger anti-nosemosis activity compared with the aqueous extracts of either A. dubia or A. scaber alone. Although the main ingredients in A. dubia and A. scaber remain unclear, our results suggest that the active components of A. dubia and A. scaber could dissolve in the aqueous fraction.

scholarly journals 1α,25-Dihydroxyvitamin D3 Supplementation during Pregnancy Is Associated with Allergic Rhinitis in the Offspring by Modulating Immunity

2021 ◽  
Vol 2021 ◽  
pp. 1-12
Author(s):  
Liqing Zhang ◽  
Haifeng Ni ◽  
Zhen Zhou ◽  
Xiaoyang Yuan ◽  
Junbo Xia ◽  
...  
Keyword(s):  
Allergic Rhinitis ◽  
Low Dose ◽  
Treg Cells ◽  
Enzyme Linked Immunosorbent Assay ◽  
Dependent Manner ◽  
Dihydroxyvitamin D3 ◽  
Sterile Saline ◽  
Maternal Supplementation ◽  
Ifn Γ ◽  
Dose Dependent

Background. Maternal supplementation with 1α,25-dihydroxyvitamin D3 (VD3) has immunologic effects on the developing fetus through multiple pathways. This study was aimed at investigating the effects of VD3 supplementation on immune dysregulation in the offspring during allergic rhinitis. Methods. Different doses of VD3 as well as control were given to pregnant female mice. Ovalbumin (OVA) challenge and aluminum hydroxide gel in sterile saline were used to induce allergic rhinitis in offspring mice. Nasal lavage fluids (NLF) were collected, and eosinophils were counted in NLF 24 hours after the OVA challenge. Th1, Th2, Th17, and Treg subtype-relevant cytokines, including IFN-γ, IL-4, IL-10, IL-17, TGF-β, and OVA-IgE levels from the blood and NLF of offspring mice, were detected by the enzyme-linked immunosorbent assay (ELISA) method. The Treg subtype was analyzed by flow cytometry. Treg cells were purified from offspring and were adoptively transferred to OVA-sensitized allogenic offspring mice. The outcomes were assessed in allogenic offspring. Results. Our data showed that VD3 supplementation significantly decreased the number of eosinophils, basophils, and lymphocytes in the peripheral blood and NLF. The proportion of CD4+CD25+FoxP3+Tregs had a positive correlation with VD3 in a dose-dependent manner. The levels of serum IgE, IL-4, and IL-17 were decreased while the expressions of IFN-γ, IL-10, and TGF-β were significantly enhanced in VD3 supplementation groups. Adoptive transfer CD4+CD25+FoxP3+Tregs of VD3 supplementation groups promoted Th1 and suppressed Th2 responses in the offspring during allergic rhinitis. Conclusion. Our findings indicated that low dose VD3 supply in pregnant mice’s diet suppressed Th2 and Th17 responses in allergic rhinitis by elevating the Th1 subtype and the proportion of CD4+CD25+FoxP3+Tregs in offspring. It suggested that low dose VD3 supply may have the potential to act as a new therapeutic strategy for allergic rhinitis.

The Anti-inflammatory Effects of Lignan Glycosides from Cistanche tubulosa stems on LPS/IFN-γ-induced RAW264.7 Macrophage Cells via PI3K/AKT Pathway

2020 ◽  
Vol 21 ◽  
Author(s):  
Jinhan Guo ◽  
Shuming Tang ◽  
Yuyang Miao ◽  
Lanlan Ge ◽  
Junfa Xu ◽  
...  
Keyword(s):  
Raw264.7 Cells ◽  
Akt Pathway ◽  
No Production ◽  
Dependent Manner ◽  
Ifn Γ ◽  
Cox 2 ◽  
Cistanche Tubulosa ◽  
Anti Inflammatory ◽  
Lignan Glycosides ◽  
Dose Dependent

Background: Cistanche tubulosa is a tonic in traditional Chinese medicines and has a broad spectrum of biological activity, including anti-inflammatory. However, its anti-inflammatory major constituents of C. tubulosa and their underlying mechanisms are still unknown. Objective: The aim of the current study was to explore the separation and structural characterization of lignan glycosides from C. tubulosa (Schenk) Wight., their anti-inflammatory activity and underlying mechanism. Materials and Methods: Fractionation and isolation of the 85% EtOH extract of C. tubulosa (Schenk) Wight. were carried out and the primary ingredients lignan glycosides (1-6) were structurally characterized. CCK8 methods were used to evaluate the cytotoxic effect of lignan glycosides (1-6). Effects of lignan glycosides (1-6) on NO production in LPS/IFN-γ-induced RAW264.7 macrophages cells were measured using Griess reagent by reaction with nitrite. The mRNA expression levels of iNOS, COX-2, IL-1β, IL-6, TNF-a, and TGF-β treated RAW264.7 cells with various concentrations (0, 25 and 50 μg/ml) of lignan glycosides (1, 4) in the presence of LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 24 h were analyzed by quantitative RT-PCR. Also the protein expressions of iNOS, COX-2, PI3K, AKT, p-AKT and β-actin were determined using Western blot analysis. A molecular docking study was performed to investigate the interactions between the lignan glycosides and the PI3K using Autodock vina 1.1.2 package. Results: Six lignan glycosides (1-6) were isolated from stems of C. tubulosa. Among them, (+)-pinoresinol-4-O-β-D-glucopyranosyl- (1→6)-β-D- glucopyranoside (5) and eleutheroside E (6) were firstly isolated from C. tubulosa. Of these lignans, 1 and 4 exhibited pronounced inhibitions on NO production with the values of 33.63 ± 4.78 and 39.28 ± 5.52 % at 50 μg/ml, respectively. Additionally, LPS/IFN-γ-induced expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-a (TNF-a) was significantly suppressed by pre-treatment of 1 and 4 in a dose-dependent manner. While 1 and 4 increased the mRNA levels of anti-inflammatory cytokines (TGF-β). Furthermore, 1 and 4 significantly inhibited the protein levels of PI3K and p-AKT in a dose-dependent manner. Conclusion: Taken together, these results suggest that 1 and 4 play an important role in the attenuation of LPS/IFN-γ-induced inflammatory responses in RAW264.7 cells and that the mechanisms involve down-regulation of the PI3K/AKT pathway.

Identification of a Functional Interferon-Gamma Response Element in the Fibrinogen FGG Gene.

Blood ◽  
2009 ◽  
Vol 114 (22) ◽  
pp. 3174-3174
Author(s):  
Chantelle M. Rein ◽  
David H. Farrell
Keyword(s):  
Hepg2 Cells ◽  
Transforming Growth Factor ◽  
Conflicts Of Interest ◽  
Consensus Sequence ◽  
Luciferase Reporter ◽  
Luciferase Expression ◽  
Dependent Manner ◽  
Down Regulation ◽  
Ifn Γ ◽  
Dose Dependent

Abstract Abstract 3174 Poster Board III-114 Fibrinogen is the zymogen precursor to the main structural protein in blood coagulation, and is proteolytically activated during coagulation to form fibrin clots. Fibrinogen is an acute phase protein that is produced by the liver, and elevated fibrinogen levels are a known risk factor for cardiovascular disease, including heart attack and stroke. Fibrinogen is synthesized from three separate genes, FGA, FGB, and FGG encoding the Aαa, Bβ, and γ chains, respectively. Several inflammatory cytokines, particularly interleukin-6 (IL-6), are known to up-regulate fibrinogen synthesis, while interleukin-1β, tumor necrosis factor-αa, and transforming growth factor-β are known to antagonize IL-6 stimulation of fibrinogen synthesis. Here we report that interferon-γ (IFN-γ), a cytokine that is highly expressed in atherosclerotic lesions, decreases the production of fibrinogen by two-fold over a 24 hour period in HepG2 hepatocellular carcinoma cells, both at the protein and mRNA level. In addition, IFN-γ antagonizes IL-6 up-regulation of fibrinogen production. Since IFN-γ is known to signal via the IFN-γ receptor through a STAT1-dependent pathway, we investigated the mechanism by which IFN-γ inhibits fibrinogen production. We identify a previously unknown IFN-γ activation sequence (GAS), AGGAGCTTACATAAAGGGACAA, within the promoter of the human γ chain gene FGG. This sequence is homologous to the known GAS consensus sequence TTNCNNNAA. Nuclear extracts from IFN-γ-stimulated HepG2 cells, but not from unstimulated HepG2 cells, form a complex with oligonucleotides containing this GAS sequence, as demonstrated by electrophoretic mobility shift assays. The formation of this complex is blocked by unlabeled competing oligonucleotides and by an antibody to phosphorylated STAT1. The involvement of pSTAT1 in this complex is consistent with the known role of pSTAT1 downstream of IFN-γ receptor signaling. In addition, IFN-γ stimulates STAT1 phosphorylation in a dose-dependent manner in HepG2 cells. Furthermore, using an FGG promoter construct fused to a luciferase reporter gene in transiently transfected HepG2 cells, we show that IFN-γ inhibits luciferase expression in a dose-dependent manner. Together, these data demonstrate that IFN-γ down-regulation of fibrinogen production occurs through a pSTAT1-mediated pathway. Since IFN-γ is known to demonstrate both pro and anti-atherogenic actions, this down-regulation of fibrinogen production may serve an anti-atherogenic function in vivo. Disclosures No relevant conflicts of interest to declare.

Lestaurtinib (CEP701) Inhibits Proliferation and Activates Apoptosis In Hodgkin Lymphoma Cells through Inhibition of the JAK/STAT Signaling Pathway

Blood ◽  
2010 ◽  
Vol 116 (21) ◽  
pp. 3919-3919
Author(s):  
Alfons Navarro ◽  
Tania Díaz ◽  
Antonio Martinez ◽  
Anna Gaya ◽  
Mariano Monzó
Keyword(s):  
Hodgkin Lymphoma ◽  
Cell Lines ◽  
Kinase Inhibitor ◽  
Conflicts Of Interest ◽  
Dependent Manner ◽  
Constitutive Activation ◽  
Downstream Target ◽  
Dose Dependent ◽  
Stat Pathway

Abstract Abstract 3919 Background: The constitutive activation of the JAK/STAT pathway plays an important role in the pathogenesis and proliferation of Hodgkin Lymphoma (HL). Although somatic activating point mutations in the JAK2 gene have been reported in myeloproliferative disorders (MPD), they are rarely described in HL, where JAK2 amplification is associated with mutations of regulator genes such as SOCS-1, constitutive activation of STAT proteins or miRNA deregulation. Recently, many JAK2 inhibitors, including Lestaurtinib (CEP701), have been reported to have clinical efficacy in MPD. CEP701 is a multitargeted tyrosine kinase inhibitor that potently inhibits FLT3 at nanomolar concentrations. Recent studies in MPD have further shown that CEP701 inhibitory activity is not limited to FLT3 and can suppress JAK2/STAT5 signaling through JAK2 inhibition. As a first step towards elucidating the potential role of CEP701 in HL therapy, we have analyzed its efficacy in vitro. Methods: Four HL cell lines, L-428, L-1236, HDMYZ and L-540, were assayed for proliferation, apoptosis and levels of proteins in the JAK2/STAT pathway (pJAK2, JAK2, pSTAT5, STAT5, Bcl-xL) after CEP701 treatment. 100,000 cells were plated in a 96-well plate in 100 ml culture medium with CEP701 or DMSO (vehicle control) at concentrations of 30–300 nM. After 1 or 24 hours of incubation with CEP701, the levels of the proteins and of FLT3 were analyzed by Western blot. Proliferation was analyzed with CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS) and apoptosis by CaspaseGlo 3/7 after 48 hours of treatment. Results: The proliferation analysis showed an effective dose-dependent inhibition of cell growth in the 4 HL cell lines after treatment with increasing concentrations of CEP701. At 48h, in comparison to cells treated with DMSO alone (normalized to 100%), in cells treated with 100nM of CEP701, we observed a marked inhibition of 35% in L-428, 55% in L-1236, 15% in HDMYZ and 77% in L-540. Moreover, apoptosis increased by 38%, 31%, 21% and 25%, respectively. The protein analysis showed that after one hour, CEP701 inhibited phosphorylation of JAK2 (pJAK2) and its downstream target STAT5 (pSTAT5) in a dose-dependent manner, with no changes in the non-phosphorylated proteins. The downstream target Bcl-xL also decreased. Conclusions: Taken together, these data demonstrate that growth inhibition and apoptosis activation by CEP701 in HL cells correlates with the inhibition of the JAK2/STAT5-dependent signal transduction pathway. Here we present the first biological evidence that Lestaurtinib could be a promising new agent in the treatment of patients with HL. Supported by a FIS grant (PS09/00547). Disclosures: No relevant conflicts of interest to declare.

Sign in / Sign up

Export Citation Format

Share Document