scholarly journals Beneficial Effects of the Five Isolates of Funneliformis mosseae on the Tomato Plants Were Not Related to Their Evolutionary Distances of SSU rDNA or PT1 Sequences in the Nutrition Solution Production

Plants ◽  
2021 ◽  
Vol 10 (9) ◽  
pp. 1948
Author(s):  
Jingyu Feng ◽  
Zhe Huang ◽  
Yongbin Zhang ◽  
Wenjing Rui ◽  
Xihong Lei ◽  
...  
Keyword(s):  
Mycorrhizal Fungi ◽  
Root Biomass ◽  
Am Fungi ◽  
Ssu Rdna ◽  
Funneliformis Mosseae ◽  
Beneficial Effects ◽  
Growing Seasons ◽  
Specific Effects ◽  
Coconut Coir ◽  
Colonization Rates

The symbiosis and beneficial effects of arbuscular mycorrhizal fungi (AM fungi) on plants have been widely reported; however, the effects might be unascertained in tomato industry production with coconut coir due to the nutrition solution supply, or alternatively with isolate-specific. Five isolates of AM fungi were collected from soils of differing geographical origins, identified as Funneliformis mosseae and evidenced closing evolutionary distances with the covering of the small subunit (SSU) rDNA regions and Pi transporter gene (PT1) sequences. The effects of these isolates on the colonization rates, plant growth, yield, and nutrition uptake were analyzed in tomato nutrition solution production with growing seasons of spring–summer and autumn–winter. Our result indicated that with isolate-specific effects, irrespective of geographical or the SSU rDNA and PT1 sequences evolution distance, two isolates (A2 and NYN1) had the most yield benefits for plants of both growing seasons, one (E2) had weaker effects and the remaining two (A2 and T6) had varied seasonal-specific effects. Inoculation with effective isolates induced significant increases of 29.0–38.0% (isolate X5, T6) and 34.6–36.5% (isolate NYN1, T6) in the plant tissues respective nitrogen and phosphorus content; the plant biomass increased by 18.4–25.4% (isolate T6, NYN1), and yields increased by 8.8–12.0% (isolate NYN1, A2) compared with uninoculated plants. The maximum root biomass increased by 28.3% (isolate T6) and 55.1% (isolate E2) in the autumn–winter and spring–summer growing seasons, respectively. This strong effect on root biomass was even more significant in an industry culture with a small volume of substrate per plant. Our results reveal the potential benefits of using selected effective isolates as a renewable resource that can overcome the suppressing effects of sufficient nutrient availability on colonization rates, while increasing the yields of industrially produced tomatoes in nutrition solution with coconut coir.

Mycorrhizal inoculation and application of Fe correction in the soil for ameliorating grapevine performance in a copper-contaminated soil

2021 ◽  
Author(s):  
Amaia Nogales ◽  
Erika S. Santos ◽  
Gonçalo Victorino ◽  
Wanda Viegas ◽  
Maria Manuela Abreu
Keyword(s):  
Soil Contamination ◽  
Contaminated Soil ◽  
Contaminated Soils ◽  
Mycorrhizal Fungi ◽  
Root Biomass ◽  
Arbuscular Mycorrhizal ◽  
Nutrient Contents ◽  
Beneficial Effects ◽  
Continuous Application ◽  
Mycorrhizal Inoculation

<p>Copper-based fungicides are commonly applied in vineyards to control fungal diseases that can severely affect grapevine productivity. Continuous application of this type of fungicides contributes to Cu accumulation in surface horizons of the soil, which can generate toxicity problems in plants, regardless of being an essential nutrient. Several strategies have been proposed to immobilize or counteract the effect of soil contaminants, such as plant inoculation with arbuscular mycorrhizal fungi (AMF). However, depending on the element concentration, this may not be sufficient to avoid its excessive accumulation in belowground and/or aboveground organs. Since Fe is known to have an antagonistic interaction with Cu in plants, Fe application, as an amendment, in vineyard soils, could be a good strategy to avoid excessive Cu uptake by grapevines growing in Cu-contaminated soils. However, little information is available on the combined effects of both strategies.</p><p>In order to reveal the possible beneficial effects of plant mycorrhization and Fe application in Cu-contaminated soils on grapevine growth and nutrition, a mesocosm experiment was established under controlled conditions. Two-year-old plants, previously inoculated or not with two different AMF, were grown in pots filled with 6.5 kg of an Arenosol collected from a wine-growing region. These plants were subjected to three soil treatments: 1) soil contamination with Cu, where the grapevines were watered with a solution containing 5.89 mg/L CuSO<sub>4</sub> to ensure that the soil in each container reached 300 mg Cu/kg; 2) soil contamination with Cu + Fe addition, where the plants were watered with a solution that contained the same amount of CuSO<sub>4</sub> plus 0.38 mg/L of FeNaEDTA·3H<sub>2</sub>O to achieve 100 mg of Fe/kg soil; and 3) non-contaminated soil watered with deionized water. Four months later, at the end of the growing season, plant vegetative growth as well as leaf and root nutrient contents were analyzed.</p><p>Grapevines inoculated with AMF demonstrated a good level of tolerance to high Cu concentrations in soil, as they presented significantly higher root biomass than non-inoculated plants and Cu was mainly accumulated in the roots avoiding its translocation to the aerial part. However, when the Cu-contaminated soil was amended with Fe, a significant decrease was observed in root biomass in all mycorrhizal inoculation treatments and Cu was accumulated in grapevine leaves. Contrastingly, Fe application helped to avoid the excessive increase of Mn concentrations in leaf and roots that is commonly induced in Cu contaminated soils, which can be detrimental for grapevine growth.</p><p>These results demonstrated that mycorrhizal inoculation is a suitable strategy to promote grapevine growth in Cu-contaminated soils. However, special attention needs to be taken when applying amendments to correct Cu contamination, as the mycorrhizal status of plants may alter the expected outcome.</p><p> </p><div> <div> </div> </div>

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals Effects of Arbuscular Mycorrhizal Fungi on Gazania rigens Pot Plant Cultivation in a Mediterranean Environment

2018 ◽  
Vol 47 (1) ◽  
pp. 221-226 ◽  
Author(s):  
Leo SABATINO ◽  
Fabio D’ANNA ◽  
Livio TORTA ◽  
Giorgio FERRARA ◽  
Giovanni IAPICHINO
Keyword(s):  
Mycorrhizal Fungi ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Dry Weight ◽  
Rhizophagus Irregularis ◽  
High Performing ◽  
Beneficial Effects ◽  
Bedding Plants ◽  
Plant Cultivation ◽  
Bedding Plant

Herbaceous plants used in island beds and borders need to be rapid growing, high performing and maintaining good visual quality during the growing season. Arbuscular mycorrhizal (AM) fungi application is acquiring interest for its beneficial effects on ornamental bedding plants. Gazania rigens is a herbaceous ornamental plant grown for its large daisy-like flowers. The species thrives in the coastal areas of the Mediterranean region, particularly in the mild climate of southern Italy and Sicily, where performs well in summer bedding schemes in sea side gardens even in dry and windy conditions. The aim of this study was to evaluate the effect of inoculation with Rhizophagus irregularis on several ornamental parameters of Gazania rigens. Prior to transplanting, three-months-old plants received a mycorrhizal inoculum carrying 40 spores g-1 of Rhizophagus irregularis. Inoculum was applied at a rate of 10 g plant-1. The AM application significantly increased number of flowers per clump by 100% and number of flowers per plant by 124.0%. Rhizophagus irregularis also positively influenced number of leaves per plant, plant height, and roots dry weight. Our findings indicated that mycorrhizal inoculation with R. irregularis may be beneficial to nursery growers wishing to produce high quality gazania for spring-summer bedding plant schemes.

scholarly journals Expression Analysis of the First Arbuscular Mycorrhizal Fungi Aquaporin Described Reveals Concerted Gene Expression Between Salt-Stressed and Nonstressed Mycelium

2009 ◽  
Vol 22 (9) ◽  
pp. 1169-1178 ◽  
Author(s):  
Ricardo Aroca ◽  
Alberto Bago ◽  
Moira Sutka ◽  
José Antonio Paz ◽  
Custodia Cano ◽  
...  
Keyword(s):  
Gene Expression ◽  
Mycorrhizal Fungi ◽  
Glomus Intraradices ◽  
Water Channel ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Beneficial Effects ◽  
Host Root ◽  
Soil Water Resources

Roots of most plants in nature are colonized by arbuscular mycorrhizal (AM) fungi. Among the beneficial effects of this symbiosis to the host plant is the transport of water by the AM mycelium from inaccessible soil water resources to host roots. Here, an aquaporin (water channel) gene from an AM fungus (Glomus intraradices), which was named GintAQP1, is reported for the first time. From experiments in different colonized host roots growing under several environmental conditions, it seems that GintAQP1 gene expression is regulated in a compensatory way regarding host root aquaporin expression. At the same time, from in vitro experiments, it was shown that a signaling communication between NaCl-treated mycelium and untreated mycelium took place in order to regulate gene expression of both GintAQP1 and host root aquaporins. This communication could be involved in the transport of water from osmotically favorable growing mycelium or host roots to salt-stressed tissues.

scholarly journals Glomus intraradices and Funneliformis mosseae am Strains Influence on Soil Physical, Biological and Chemical Characteristics in Tea Plantations in Kenya

2021 ◽  
pp. 13-18
Author(s):  
Awa Chelangat ◽  
Joseph P Gweyi-Onyango ◽  
Nicholas K Korir ◽  
Maina Mwangi
Keyword(s):  
Mycorrhizal Fungi ◽  
Glomus Intraradices ◽  
Block Design ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Climatic Conditions ◽  
Soil Microbiology ◽  
Funneliformis Mosseae ◽  
Wide Range ◽  
Tea Production

Arbuscular mycorrhizal (AM) fungi occur over a wide range of agro climatic conditions and are geographically ubiquitous. Arbuscular mycorrhizal fungi are the medium of soil structure, they determine the flow of water, nutrients, and air, directs the pathways of root growth, and opens channels for the movement of soil animals. As the moderator of the microbial community, they also determine the metabolic processes of the soil. In other words, the mycorrhizal network is practically synonymous with ecosystem function. The tremendous advances in research on mycorrhizal physiology and ecology over the past 40 years have led to a greater understanding of the multiple roles of AMF in the ecosystem. The current study was informed due to the depletion of nutrients and poor soil microbiology in tea production whose production has declined in the recent years. The trial was conducted in the research and development greenhouse at the James Finlays Farm in Kericho County, Kenya. The experiment was laid out in a Randomized Complete Block Design (RCBD) with factorial arrangements of tea clones and mycorrhizae levels. The phosphorus treatments consisted of a standard rate of 107.66kg ha -1, two clones of the tea (S15/10 and SC 12/28) and two mycorrhizal strains (Funneliformis mosseae and Glomus intraradices) at two rates (50 kg ha-1 and 70 kg ha-1) and an untreated control without mycorrhizae. The soil pH was positively influenced by reducing the acidity content significantly where mycorrhizae strains were introduced with the highest unit change (1.3) was recorded on clone SC 12/28 at the 50 kg Mycorrhizae ha-1 rate. The same treatment also significantly increased the soil total phosphorus level (2.3 g/kg) compared to all other treatments with the least change observed on the control. Application of AMF strains Glomus intraradices and Funneliformis mosseae is recommended in tea production at the rate of 50 kg ha-1 which improves and enhances the general positive characteristics of soil health.

Long-term effect of heavy metal loads on the mycorrhizal colonization and metal uptake of barley

2010 ◽  
Vol 59 (1) ◽  
pp. 175-184
Author(s):  
B. Biró ◽  
A. Füzy ◽  
K. Posta
Keyword(s):  
Host Plant ◽  
Root System ◽  
Biomass Production ◽  
Contaminated Soils ◽  
Mycorrhizal Fungi ◽  
Root Biomass ◽  
Infection Intensity ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi

A pot experiment was designed to study the colonization of indigenous arbuscular mycorrhizal fungi (AMF) on barley ( Hordeum vulgare L.) host plant. Soils of the pots were collected from a long-term field microelement loading experiment on calcareous chernozem soil twelve years after 13 heavy metals (Al, As, Ba, Cd, Cr, Cu, Hg, Mo, Ni, Pb, Se, Sr and Zn) were applied once in four doses (0, 30, 90 and 270 mg element·kg -1 d.w.). The biomass production and element accumulation of the host plant, the various colonization values of the arbuscular mycorrhiza fungi (AMF) – such as colonization intensity (M %), arbusculum richness (A %) in the root system and the sporulation intensity (g -1 dry soil) in the rhizosphere – were measured. When considering the twelve-year adaptation process of the AM fungal populations at the various metal loads, a relatively balanced inside mycorrhiza colonization was found, suggesting the potentials for the selection of tolerant fungi in metal contaminated soils. The balanced infection intensity (M %) of the AM fungi and their common strategies with the host plant have resulted a nonsignificant shoot and root biomass production of barley in general. Mycorrhiza sporulation in the root system proved to be much variable and indicated the toxicity of metals and metal rates. Cd, Pb and Sr elements significantly reduced spore numbers, while a value of 34 spores·g -1 soil was counted in the case of Ni in comparison to the control’s 22 spores·g -1 soil value. Stress-defending strategies of the fungal–plant symbiosis, such as the increased arbusculum richness (A %) could be established for the Hg and Pb rates. In the case of Cd an increased root biomass production became a tool for stress alleviation and reduced the metal allocation towards the shoots. Mycorrhiza fungi are part of the common plant–microbe interactions and appropriate defending mechanisms in metal contaminated soils.

scholarly journals Ectomycorrhizal Fungal Inoculation of Sphaerosporella brunnea Significantly Increased Stem Biomass of Salix miyabeana and Decreased Lead, Tin, and Zinc, Soil Concentrations during the Phytoremediation of an Industrial Landfill

2020 ◽  
Vol 6 (2) ◽  
pp. 87 ◽  
Author(s):  
Dimitri J. Dagher ◽  
Frédéric E. Pitre ◽  
Mohamed Hijri
Keyword(s):  
Trace Element ◽  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Symbiotic Associations ◽  
Growing Seasons ◽  
Abiotic Stressors ◽  
Sphaerosporella Brunnea ◽  
Am Fungus

Fast growing, high biomass willows (Salix sp.) have been extensively used for the phytoremediation of trace element-contaminated environments, as they have an extensive root system and they tolerate abiotic stressors such as drought and metal toxicity. Being dual mycorrhizal plants, they can engage single or simultaneous symbiotic associations with both arbuscular mycorrhizal (AM) fungi and ectomycorrhizal (EM) fungi, which can improve overall plant health and growth. The aim of this study was to test the effect of these mycorrhizal fungi on the growth and trace element (TE) extraction potential of willows. A field experiment was carried out where we grew Salix miyabeana clone SX67 on the site of a decommissioned industrial landfill, and inoculated the shrubs with an AM fungus Rhizophagus irregularis, an EM fungus Sphaerosporella brunnea, or a mixture of both. After two growing seasons, the willows inoculated with the EM fungus S. brunnea produced significantly higher biomass. Ba, Cd and Zn were found to be phytoextracted to the aerial plant biomass, where Cd presented the highest bioconcentration factor values in all treatments. Additionally, the plots where the willows received the S. brunnea inoculation showed a significant decrease of Cu, Pb, and Sn soil concentrations. AM fungi inoculation and dual inoculation did not significantly influence biomass production and soil TE levels.

scholarly journals Growth Responses of Boreal Scots Pine, Norway Spruce and Silver Birch Seedlings to Simulated Climate Warming over Three Growing Seasons in a Controlled Field Experiment

Forests ◽  
2020 ◽  
Vol 11 (9) ◽  
pp. 943
Author(s):  
Katri Nissinen ◽  
Virpi Virjamo ◽  
Antti Kilpeläinen ◽  
Veli-Pekka Ikonen ◽  
Laura Pikkarainen ◽  
...  
Keyword(s):  
Norway Spruce ◽  
Scots Pine ◽  
Root Biomass ◽  
Growing Season ◽  
Silver Birch ◽  
Shoot Biomass ◽  
Growth Responses ◽  
Growing Seasons ◽  
Simulated Climate ◽  
Shoot And Root Biomass

We studied the growth responses of boreal Scots pine (Pinus sylvestris L.), Norway spruce (Picea abies L. Karst.) and silver birch (Betula pendula Roth) seedlings to simulated climate warming of an average of 1.3 °C over the growing season in a controlled field experiment in central Finland. We had six replicate plots for elevated and ambient temperature for each tree species. The warming treatment lasted for the conifers for three growing seasons and for the birch two growing seasons. We measured the height and diameter growth of all the seedlings weekly during the growing season. The shoot and root biomass and their ratios were measured annually in one-third of seedlings harvested from each plot in autumn. After two growing seasons, the height, diameter and shoot biomass were 45%, 19% and 41% larger in silver birch seedlings under the warming treatment, but the root biomass was clearly less affected. After three growing seasons, the height, diameter, shoot and root biomass were under a warming treatment 39, 47, 189 and 113% greater in Scots pine, but the root:shoot ratio 29% lower, respectively. The corresponding responses of Norway spruce to warming were clearly smaller (e.g., shoot biomass 46% higher under a warming treatment). As a comparison, the relative response of height growth in silver birch was after two growing seasons equal to that measured in Scots pine after three growing seasons. Based on our findings, especially silver birch seedlings, but also Scots pine seedlings benefitted from warming, which should be taken into account in forest regeneration in the future.

scholarly journals Micro-Landscape Dependent Changes in Arbuscular Mycorrhizal Fungal Community Structure

2021 ◽  
Vol 11 (11) ◽  
pp. 5297
Author(s):  
Stavros D. Veresoglou ◽  
Leonie Grünfeld ◽  
Magkdi Mola
Keyword(s):  
Community Structure ◽  
Mycorrhizal Fungi ◽  
Root Colonization ◽  
Environmental Parameters ◽  
Arbuscular Mycorrhizal ◽  
Fungal Community Structure ◽  
High Connectivity ◽  
Spatio Temporal ◽  
Arbuscular Mycorrhizal Fungal ◽  
Colonization Rates

The roots of most plants host diverse assemblages of arbuscular mycorrhizal fungi (AMF), which benefit the plant hosts in diverse ways. Even though we understand that such AMF assemblages are non-random, we do not fully appreciate whether and how environmental settings can make them more or less predictable in time and space. Here we present results from three controlled experiments, where we manipulated two environmental parameters, habitat connectance and habitat quality, to address the degree to which plant roots in archipelagos of high connectivity and invariable habitats are colonized with (i) less diverse and (ii) easier to predict AMF assemblages. We observed no differences in diversity across our manipulations. We show, however, that mixing habitats and varying connectivity render AMF assemblages less predictable, which we could only detect within and not between our experimental units. We also demonstrate that none of our manipulations favoured any specific AMF taxa. We present here evidence that the community structure of AMF is less responsive to spatio-temporal manipulations than root colonization rates which is a facet of the symbiosis which we currently poorly understand.

Sign in / Sign up

Export Citation Format

Share Document