scholarly journals Evaluation of Real-time PCR for Diagnosis of Post-Kala-azar Dermal Leishmaniasis in Endemic Foci of Bangladesh

2018 ◽  
Vol 5 (10) ◽  
Author(s):  
Prakash Ghosh ◽  
Md Golam Hasnain ◽  
Faria Hossain ◽  
Md Anik Ashfaq Khan ◽  
Rajashree Chowdhury ◽  
...  
Keyword(s):  
Real Time ◽  
Clinical Examination ◽  
Real Time Pcr ◽  
Potential Method ◽  
Diagnostic Methods ◽  
Promising Tool ◽  
Kala Azar ◽  
Polymerase Chain ◽  
Strip Test ◽  
Treatment Prognosis

Abstract Background Post-kala-azar dermal leishmaniasis (PKDL) is a sequel to visceral leishmaniasis (VL), which is found in VL-endemic countries including Bangladesh. Because of these enigmatic cases, the success of the National Kala-azar Elimination Program is under threat. To date, diagnostic methods for PKDL cases in endemic regions have been limited to clinical examination and rK39 test or microscopy, and a suitable and accurate alternative method is needed. In this study, we investigated the application of real-time polymerase chain reaction (PCR) as a potential method for diagnosis of PKDL in comparison with microscopy. Methods Ninety-one suspected macular PKDL cases from Mymensingh district, Bangladesh, were enrolled in the study after diagnosis by clinical examination and an rK39 strip test. All of them responded after completion of the treatment with miltefosine. During enrollment, a skin biopsy was done for each patient, and both microscopy and real-time PCR were performed for detection and quantification of Leishmania donovan body (LDB) and LD DNA, respectively. Results Real-time PCR detected 83 cases among all suspected PKDL patients, with an encouraging sensitivity of 91.2% (83.4%–96.1%), whereas microscopy showed 50.6% (39.9%–61.2%) sensitivity. Among all suspected PKDL cases, 42 cases were positive in both microscopy and qPCR, whereas 41 cases were detected as positive through qPCR only. Conclusions This study provides evidence that real-time PCR is a promising tool for diagnosis of PKDL in endemic regions. In addition to diagnosis, the quantitative ability of this method could be further exploited for after-treatment prognosis and cure assessment of PKDL cases.

scholarly journals Molecular diagnosis of Anaplasma marginale in cattle: quantitative evaluation of a real-time PCR (Polymerase Chain Reaction) based on msp5 gene

2014 ◽  
Vol 34 (1) ◽  
pp. 29-33 ◽  
Author(s):  
Gisele M. Bacanelli ◽  
Carlos A. N. Ramos ◽  
Flábio R. Araújo
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Anaplasma Marginale ◽  
Diagnostic Methods ◽  
Molecular Diagnostic ◽  
Chain Reaction ◽  
The Real ◽  
End Point ◽  
Polymerase Chain

The rickettsia Anaplasma marginale is considered the main agent of bovine anaplasmosis. Due the nonspecific clinical signs of the anaplasmosis, the diagnosis of infection depends of laboratory confirmation. In recent years, molecular diagnostic methods have been used to detect A. marginale in cattle. However, the existence of a large number of assays of different sensitivity and cost makes the choice of an appropriate test difficult. In the present study, a real-time Polymerase Chain Reaction (PCR) based on the msp5 target gene was quantitatively assessed and compared to an end point PCR. Both reactions were subjected to sensitivity and specificity evaluation using plasmid DNA and samples from cattle experimentally infected with A. marginale. A comparative field trial of the tests was carried out using samples of cattle from a stable enzootic area for A. marginale. The real-time PCR showed a higher sensitivity than the end point PCR. This reaction (i.e. real-time PCR) was able to detect one copy of the msp5 gene in 100 ηg of plasmidial DNA, and more than 80% of its results were positive among experimentally infected animals seven days after infection. In addition, based on in silico analysis, the real-time PCR evaluated in the present study appears to be useful for the detection of A. ovis.

DEVELOPMENT OF MULTIPLEX REAL-TIME PCR ASSAY FOR SIX PATHOGENS: RAPID TOOL FOR DIAGNOSIS OF BACTERIAL MENINGITIS

2019 ◽  
pp. 60-66
Author(s):  
Viet Quynh Tram Ngo ◽  
Thi Ti Na Nguyen ◽  
Hoang Bach Nguyen ◽  
Thi Tuyet Ngoc Tran ◽  
Thi Nam Lien Nguyen ◽  
...  
Keyword(s):  
Bacterial Meningitis ◽  
Real Time ◽  
Real Time Pcr ◽  
Diagnostic Methods ◽  
Type B ◽  
E Coli ◽  
Pcr Assays ◽  
Set Up ◽  
Etiological Agents ◽  
Suis Serotype

Introduction: Bacterial meningitis is an acute central nervous infection with high mortality or permanent neurological sequelae if remained undiagnosed. However, traditional diagnostic methods for bacterial meningitis pose challenge in prompt and precise identification of causative agents. Aims: The present study will therefore aim to set up in-house PCR assays for diagnosis of six pathogens causing the disease including H. influenzae type b, S. pneumoniae, N. meningitidis, S. suis serotype 2, E. coli and S. aureus. Methods: inhouse PCR assays for detecting six above-mentioned bacteria were optimized after specific pairs of primers and probes collected from the reliable literature resources and then were performed for cerebrospinal fluid (CSF) samples from patients with suspected meningitis in Hue Hospitals. Results: The set of four PCR assays was developed including a multiplex real-time PCR for S. suis serotype 2, H. influenzae type b and N. meningitides; three monoplex real-time PCRs for E. coli, S. aureus and S. pneumoniae. Application of the in-house PCRs for 116 CSF samples, the results indicated that 48 (39.7%) cases were positive with S. suis serotype 2; one case was positive with H. influenzae type b; 4 cases were positive with E. coli; pneumococcal meningitis were 19 (16.4%) cases, meningitis with S. aureus and N. meningitidis were not observed in any CSF samples in this study. Conclusion: our in-house real-time PCR assays are rapid, sensitive and specific tools for routine diagnosis to detect six mentioned above meningitis etiological agents. Key words: Bacterial meningitis, etiological agents, multiplex real-time PCR

scholarly journals Role of Laboratory Medicine in SARS-CoV-2 Diagnostics. Lessons Learned from a Pandemic

Healthcare ◽  
2021 ◽  
Vol 9 (7) ◽  
pp. 915
Author(s):  
Irena Duś-Ilnicka ◽  
Aleksander Szymczak ◽  
Małgorzata Małodobra-Mazur ◽  
Miron Tokarski
Keyword(s):  
Molecular Biology ◽  
Real Time ◽  
Real Time Pcr ◽  
Laboratory Medicine ◽  
Lessons Learned ◽  
Diagnostic Methods ◽  
Medical Community ◽  
Medical Diagnostic ◽  
Novel Coronavirus ◽  
Available Information

Since the 2019 novel coronavirus outbreak began in Wuhan, China, diagnostic methods in the field of molecular biology have been developing faster than ever under the vigilant eye of world’s research community. Unfortunately, the medical community was not prepared for testing such large volumes or ranges of biological materials, whether blood samples for antibody immunological testing, or salivary/swab samples for real-time PCR. For this reason, many medical diagnostic laboratories have made the switch to working in the field of molecular biology, and research undertaken to speed up the flow of samples through laboratory. The aim of this narrative review is to evaluate the current literature on laboratory techniques for the diagnosis of SARS-CoV-2 infection available on pubmed.gov, Google Scholar, and according to the writers’ knowledge and experience of the laboratory medicine. It assesses the available information in the field of molecular biology by comparing real-time PCR, LAMP technique, RNA sequencing, and immunological diagnostics, and examines the newest techniques along with their limitations for use in SARS-CoV-2 diagnostics.

Diagnosis and Causative Species of Visceral Leishmaniasis in Southwest Saudi Arabia

2021 ◽  
Author(s):  
Aymen Abdelhaleem ◽  
Nabil Dhayhi ◽  
Mohamed Salih Mahfouz ◽  
Ommer Daffalla ◽  
Mansour Mubarki ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Visceral Leishmaniasis ◽  
Real Time ◽  
Real Time Pcr ◽  
Leishmania Donovani ◽  
Target Genes ◽  
Sample Volume ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Robust Evidence

Visceral leishmaniasis (VL) is the most severe clinical form of the disease and has been reported in the Jazan region of southwest Saudi Arabia. This study aimed to diagnose VL by real-time polymerase chain reaction (PCR) and the direct agglutination test (DAT) and to identify the causative Leishmania species. A total of 80 participants, including 30 suspected VL patients, 30 healthy endemic control individuals, and 20 malaria disease controls, were enrolled in this study. Blood samples were collected and tested for Leishmania DNA by real-time PCR and for antibody by the DAT. Sequencing of some amplified PCR products was used to identify the causative Leishmania species. The diagnosis of VL was successfully achieved by both real-time PCR and by DAT with 100% sensitivity. Leishmania donovani and Leishmania infantum species were detected by sequencing both by the kDNA and ITS1 target genes, followed a BLASTn search. The detection of VL antibody by the DAT followed by the confirmatory detection of Leishmania DNA in patient blood by PCR could promote the adoption of the much less invasive and more sensitive methods for the routine diagnosis of VL. Further study with high sample volume to evaluate the PCR and the DAT are needed, to generate more robust evidence. Based on the sequencing results, emerging studies on VL should focus on the causative Leishmania species, reservoirs, and vectors that are important in the study area.

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Cryptosporidium spp. during chemotherapy: a cross-sectional study of 94 patients with malignant solid tumor

2021 ◽  
Vol 41 (5) ◽  
pp. 293-298
Author(s):  
Mehmet Karabey ◽  
Hüseyin Can ◽  
Tülay Öncü Öner ◽  
Mert Döşkaya ◽  
Sedef Erkunt Alak ◽  
...  
Keyword(s):  
Sample Size ◽  
Real Time ◽  
Solid Tumors ◽  
Real Time Pcr ◽  
Tertiary Care ◽  
Diagnostic Methods ◽  
Cross Sectional ◽  
Cryptosporidium Spp ◽  
Stool Samples ◽  
Pcr Targeting

BACKGROUND: Cryptosporidium spp . is a protozoan parasite that infects many vertebrate animals, including humans. Since Cryptosporidium spp . can cause chronic life-threatening diarrhea and severe malabsorption in immunocompromised patients, we investigated the prevalence of this parasite among patients undergoing chemotherapy for malignant solid tumors. OBJECTIVE: Investigate the prevalence of Cryptosporidium spp . in stool samples. DESIGN: Cross-sectional. SETTING: Tertiary care. PATIENTS AND METHODS: Stool samples were collected from adult patients with malignant solid tumors receiving chemotherapy and diarrhea. Cryptosporidium spp . prevalence was determined using Ziehl–Neelsen staining, ELISA, and real-time PCR targeting of the COWP gene. MAIN OUTCOME MEASURE: The prevalence of Cryptosporidium spp . in patients undergoing chemotherapy for malignant solid tumors. SAMPLE SIZE: 94 RESULTS: The prevalence was 2.1% (2/94), 5.3% (5/94), and 5.3% (5/94) as detected by Ziehl–Neelsen staining, real-time PCR and ELISA, respectively. The prevalence reached 8.5% (8/94) using all results obtained from the three methods. Among eight positive stool samples, four were positive by at least two different methods (Ziehl–Neelsen staining-ELISA or ELISA-real-time PCR) whereas the remaining four were positive by either ELISA or real-time PCR. CONCLUSION: These findings show the risk of cryptosporidiosis in cancer patients and the necessity to use at least two diagnostic methods during the diagnosis of cryptosporidiosis to reach more accurate and trustworthy results. LIMITATIONS: Further studies with a larger sample size are recommended. CONFLICT OF INTEREST: None.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

Epidemiology of Epizootic Lymphangitis of cart horses in Northern Ethiopia Using Conventional diagnostic Methods and Nested Polymerase Chain Reaction

2019 ◽  
Author(s):  
Birhanu Hadush Abera ◽  
Molla Michaelay ◽  
Habtamu Taddele ◽  
Nigus Abebe ◽  
Abrha Tesfay ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Clinical Examination ◽  
Roc Curve ◽  
Nested Pcr ◽  
Control Measure ◽  
Diagnostic Methods ◽  
Northern Ethiopia ◽  
Chain Reaction ◽  
Nested Polymerase Chain Reaction ◽  
Polymerase Chain

Abstract Background: Epizootic lymphangitis (EL), caused by Histoplasma capsulatum variety farciminosum (HCF) is a contagious chronic disease of equines characterized by development of nodular lesions in the lymph nodes, lymphatic vessels and skin. This disease is the most important diseases of equines in Ethiopia causing a significant economic loss, particularly cart pulling equines. Todate there is no sound diagnostic nor control measure implemented in the country. Furthermore, there is a shortage of data on the epidemiology of the disease in different regions of the country including northern Ethiopia. This study was conducted to investigate the epidemiology of EL in northern Ethiopia using the conventional methods and the nested polymerase chain reaction (PCR). Methods: A total of 191 cart-horses were enrolled and used as sources of pus and blood samples. The blood was used for the extraction of the DNA of HCF from buffy coat for nested PCR while the pus samples were cultured on Sabourauds Dextrose Agar for isolation. Statistical Package for Social Sciences (SPSS) version 21 was used for data analysis by applying logistic regression, receiver operating characteristic (ROC) curve and Cohen’s kappa coefficient test. In addition, the level of agreement between the clinical examination and the nested PCR was evaluated. Results: Infection with HCF was confirmed in 44% (84/191) of the horses using nested PCR. Subclinical infection was observed in 18.18% (22/121) of the apparently healthy horses. Considering nested PCR as a gold standard, the sensitivity and specificity of the clinical examination were 74% and 95%, respectively while the area under the ROC curve (AUR) was 0.83 (95% confidence interval, 0.77, 0.896). Moreover, a moderate (k=0.675) agreement was observed between the nested PCR and clinical examination.Conclusions: The findings of the present study showed the wide spread occurrence of EL in northern Ethiopia and the advantage of the nested PCR in detecting of the infection of HCF even before the clinical symptoms are apparent.

Sign in / Sign up

Export Citation Format

Share Document