scholarly journals Incidence of Salmonella and Escherichia coli in fish farms and markets in Dinajpur, Bangladesh

2020 ◽  
Vol 55 (1) ◽  
pp. 65-72
Author(s):  
A Ava ◽  
M Faridullah ◽  
UJ Lithi ◽  
VC Roy
Keyword(s):  
Escherichia Coli ◽  
Water Samples ◽  
Research Work ◽  
Fish Sample ◽  
Fish Farms ◽  
E Coli ◽  
Fish Samples

The research work was conducted to assess the incidence of Salmonella and Escherichia coli (E. coli) contamination in different fish farms and fish markets of Dinajpur district of Bangladesh. The level of incidence of Salmonella contamination was greater in scum samples (93.8%) and for E. coli the higher contamination found in water samples (81.3%). The study showed that, water and fish samples were also Salmonella positive and the percentage was 87.5% and 57.8% respectively and for E. coli contamination about 75% of scum and 75.6% of fish samples were E. coli positive among fish farms samples. In case of market, both basket and fish sample were tested Salmonella positive, the level of incidence of Salmonella contamination was higher for basket samples (100%) and lower in fish samples (48.9%). Meanwhile, E. coli contamination for fish, basket, and mat samples were 75.6%, 68.8% and 75% respectively. Therefore, the results are very much alarming. Bangladesh J. Sci. Ind. Res.55(1), 65-72, 2020

An Improved Membrane Filtration Method for Enumeration of Faecal Coliforms and E. Coli by a Fluorogenic β-Glucuronidase Assay

1993 ◽  
Vol 27 (3-4) ◽  
pp. 267-270 ◽  
Author(s):  
M. T. Augoustinos ◽  
N. A. Grabow ◽  
B. Genthe ◽  
R. Kfir
Keyword(s):  
Escherichia Coli ◽  
Water Samples ◽  
Membrane Filtration ◽  
Faecal Coliforms ◽  
Environmental Waters ◽  
Filtration Method ◽  
E Coli ◽  
Wide Range ◽  
Pure Cultures ◽  
Glucuronidase Assay

A fluorogenic β-glucuronidase assay comprising membrane filtration followed by selective enumeration on m-FC agar at 44.5°C and further confirmation using tlie 4-metliylumbelliferyl-β-D-glucuronide (MUG) containing medium was evaluated for the detection of Escherichia coli in water. A total of 200 typical blue and non-typical blue colonies were isolated from sea and fresh water samples using initial selective enumeration on m-FC agar. Pure cultures of the selected colonies were further tested using the MUG assay and identified using the API 20E method. Of the colonies tested which were shown to be positive using the MUG assay 99.4% were Escherichia coli. The results of this study indicate the combination of the m-FC method followed by the MUG assay to be highly efficient for the selection and confirmation of E. coli from a wide range of environmental waters.

Growth of Selected Cross-Contaminating Bacterial Pathogens on Beef and Fish at 15 and 35°C+

1994 ◽  
Vol 57 (4) ◽  
pp. 337-340 ◽  
Author(s):  
AJIBOLA O. FAPOHUNDA ◽  
KENNETH W. MCMILLIN ◽  
DOUGLAS L. MARSHALL ◽  
W. M. WAITES
Keyword(s):  
Escherichia Coli ◽  
Clostridium Perfringens ◽  
Aeromonas Hydrophila ◽  
Growth Response ◽  
Cross Contamination ◽  
Limited Growth ◽  
E Coli ◽  
Fish Samples ◽  
Conditioning Temperature ◽  
The Tropics

Isolates of Escherichia coli and Clostridium perfringens from beef and Aeromonas hydrophila from fish were examined for their ability to survive and grow as cross-contaminates on nonnative tissues at simulated ambient (35°C) and aging/conditioning (15°C) temperatures of handling and retailing found in the tropics. Growth of all isolates over a 10-h period was greater (P < 0.05) on their native tissues at both temperatures. The aging/conditioning temperature effectively limited growth of E. coli and A. hydrophila to less than l-logl0 CFU/g and prevented growth of C. perfringens on beef and fish samples. All three isolates demonstrated characteristic mesophilic growth response on both tissues at 35°C during the 10-h retail period. The study suggests that two muscle food products could be jointly handled to efficiently use available storage/haulage capacity in tropical countries. Potential savings in space, labor and energy would be made if cross-contamination between the two products is minimized by available packaging and sanitizing technologies.

scholarly journals Detection of antimicrobial resistance genes of carbapenem-resistant Enterobacteriaceae in Escherichia coli isolated from the water supply of smallholder dairy farms in Saraburi and Maha Sarakham, Thailand

2020 ◽  
Vol 6 (1) ◽  
pp. 1-5
Author(s):  
Natapol Pumipuntu ◽  
Sangkom Pumipuntu
Keyword(s):  
Escherichia Coli ◽  
Antimicrobial Resistance ◽  
Resistance Genes ◽  
Water Samples ◽  
Dairy Farms ◽  
Drug Resistant ◽  
E Coli ◽  
Carbapenem Resistant ◽  
Carbapenem Resistant Enterobacteriaceae ◽  
Smallholder Dairy Farms

Background and Aim: The problem of antimicrobial resistance of bacteria in both humans and animals is an important public health concern globally, which is likely to increase, including in Thailand, where carbapenem-resistant Enterobacteriaceae (CRE), such as Escherichia coli, are of particular concern. They are pathogens found in the gastrointestinal tract of humans and other animals as well as in the environment. They may cause opportunistic infection and are often resistant to antibiotics in various fields especially in animal husbandry, such as pets or livestock farms. This study aimed to investigate the occurrence of carbapenem-resistant E. coli from water samples of smallholder dairy farms in Saraburi and Maha Sarakham, Thailand. Materials and Methods: Sixty-four water samples were collected from 32 dairy farms in Kaeng Khoi district, Muak Lek district, and Wang Muang district of Saraburi Province, and Kantharawichai district and Mueang district of Maha Sarakham Province, Thailand. All samples were cultured and isolated for E. coli by biochemical tests. All E. coli isolates were tested for drug susceptibility using imipenem, meropenem, and drug resistance genes of carbapenemases such as blaNDM, blaIMP, and blaOXA48 of drug-resistant E. coli isolates detected by polymerase chain reaction (PCR) technique. Results: A total of 182 E. coli isolates were found (140 and 42 isolates from Saraburi and Maha Sarakham, respectively). Drug sensitivity tests found that two isolates of E. coli from water in Kaeng Khoi were resistant to imipenem; therefore, the incidence of E. coli resistance to carbapenem was 1.43% of Saraburi Province. On the other hand, there was no incidence of drug-resistant E. coli in Maha Sarakham. In addition, the detection of the drug-resistant gene of E. coli in both isolates by PCR showed the expression of blaNDM. Conclusion: This study reports E. coli resistance to antimicrobial drugs on livestock farms. It can be considered to be the first report of E. coli CRE detection in a dairy farm at Saraburi, which should be the subject of further extended study.

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

scholarly journals Isolation and Enumeration of Escherichia coli from Soil and Water

2020 ◽  
Vol 36 (2) ◽  
pp. 75-77
Author(s):  
Anindita Bhowmik ◽  
Sunjukta Ahsan
Keyword(s):  
Escherichia Coli ◽  
Water Samples ◽  
Gas Production ◽  
Soil Samples ◽  
Most Probable Number ◽  
Biochemical Tests ◽  
Probable Number ◽  
E Coli ◽  
Dilution Series

Majority of the population of Bangladesh depend on tap or surface water as their source of water supply. This study was carried out to examine the microbial quality of both water and soil collected from different places using the multiple tube fermentation technique to determine coliform count by the most probable number (MPN) method in brilliant green lactose broth (BGLB) media.Inoculum from positive tubes of the presumptive test were further transferred on eosinemethylene blue (EMB) and MacConkey agar.The organisms isolated were further characterized using biochemical tests. Out of 93 water samples, 30 (32.26%) indicated the presence of lactose fermenter and gas producer in all 3 tubes of dilution series using inoculum quantities of 1.0, 0.1 and 0.01 ml, whereas out of 85 soil samples, 45 (52.94%) showed acid and gas production in all 3 tubes of dilution series.Among 85 soil samples, 40 samples that contained at least one positive in each dilution series and among 93 water samples, 31 samples that contained at least one positive in each dilution series were further re-identified with biochemical tests.This study showed 30.59% soil isolates and 26.88% water isolates were Escherichia coli which highlighted the fact that both water and soil act as a major reservoir of E.coli, which indicates possible fecal contamination as well as presence of potentially pathogenic E. coli. Bangladesh J Microbiol, Volume 36 Number 2 December 2019, pp 75-77

scholarly journals Clonal Populations of ThermotolerantEnterobacteriaceae in Recreational Water and Their Potential Interference with Fecal Escherichia coli Counts

2001 ◽  
Vol 67 (10) ◽  
pp. 4934-4938 ◽  
Author(s):  
Sandra L. McLellan ◽  
Annette D. Daniels ◽  
Alissa K. Salmore
Keyword(s):  
Escherichia Coli ◽  
Water Samples ◽  
Environmental Protection Agency ◽  
16S Rrna Gene Sequencing ◽  
Fecal Coliforms ◽  
Rrna Gene ◽  
Bacterial Strains ◽  
Diverse Range ◽  
E Coli ◽  
Glucuronidase Activity

ABSTRACT Bacterial strains were isolated from beach water samples using the original Environmental Protection Agency method for Escherichia coli enumeration and analyzed by pulsed-field gel electrophoresis (PFGE). Identical PFGE patterns were found for numerous isolates from 4 of the 9 days sampled, suggesting environmental replication. 16S rRNA gene sequencing, API 20E biochemical testing, and the absence of β-glucuronidase activity revealed that these clonal isolates were Klebsiella, Citrobacter, and Enterobacter spp. In contrast, 82% of the nonclonal isolates from water samples were confirmed to be E. coli, and 16% were identified as other fecal coliforms. These nonclonal isolates produced a diverse range of PFGE patterns similar to those of isolates obtained directly from untreated sewage and gull droppings. β-Glucuronidase activity was critical in distinguishingE. coli from other fecal coliforms, particularly for the clonal isolates. These findings demonstrate that E. coli is a better indicator of fecal pollution than fecal coliforms, which may replicate in the environment and falsely elevate indicator organism levels.

scholarly journals Occurrence and Determination of Antimicrobial Resistant Escherichia coli Isolates in Fish and Vegetables as Indicator Organism of Faecal Contamination in Dar es Salaam, Tanzania

2021 ◽  
Vol 2021 ◽  
pp. 1-9
Author(s):  
Francis Mwanza ◽  
Erick Vitus Gabriel Komba ◽  
Dominic Mukama Kambarage
Keyword(s):  
Escherichia Coli ◽  
Genetic Diversity ◽  
Genetic Relatedness ◽  
Diffusion Method ◽  
Urban Farming ◽  
Biochemical Tests ◽  
Typing Method ◽  
Organic Fertiliser ◽  
E Coli ◽  
Fish Samples

Escherichia coli such as E. coli O157:H7, a non-sorbitol-fermenting (NSF) E. coli, is an essential human pathogen among other common zoonotic pathogens carried by animals especially cattle. They are discharged through cattle faeces into the environment. With the increasing practice of urban farming, livestock manure is used as organic fertiliser in either fish ponds or vegetable gardens. This practice increases the risk of transmission of such pathogens to humans. This study aimed at determining the occurrence, antimicrobial resistance profiles, and genetic relatedness of E. coli isolates from manure, vegetables, and fish. Microbiological standard methods were used to isolate and identify E. coli isolates from manure, vegetable, and fish samples. Confirmed isolates on biochemical tests were tested for resistance against six antibiotics using the disc diffusion method. Enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) typing method was used to generate fingerprints and determine the genetic relatedness of the E. coli isolates. Of 156 samples including 89 manure, 53 vegetables, and 16 fish, 36 (23.1%) samples were positive for E. coli from where a total of 48 E. coli different isolates were recovered that were subjected to antimicrobial susceptibility testing and genetic relatedness. Of these isolates, 25 (52.1%) were resistant to at least one antimicrobial agent and 12 (48.0%) showed multidrug resistance. ERIC-PCR profiles of E. coli isolates from manure, vegetables, and fish showed genetic diversity with genetic relatedness ranging from 74.5% to 100%. Nine phylogenetic clusters (I–IX) determined at 90% threshold level of genetic relatedness were identified among the isolates. This study determined the occurrence, antimicrobial resistant patterns, and genetic diversity of antimicrobial-resistant E. coli isolates from different sources. This study showed the potential of microbial health risk to humans through contamination, and hence, it is necessary to monitor and improve husbandry practices in urban farming.

scholarly journals DIARRHEAGENIC Escherichia coli IN RAW MILK, WATER, AND CATTLE FECES IN NON-TECHNIFIED DAIRY FARMS

2019 ◽  
Vol 20 ◽  
Author(s):  
Laryssa F. Ribeiro ◽  
Mayhara M. C. Barbosa ◽  
Fernanda R. Pinto ◽  
Leticia F. Lavezzo ◽  
Gabriel A. M. Rossi ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Water Samples ◽  
Dairy Farms ◽  
Raw Milk ◽  
Human Consumption ◽  
E Coli ◽  
Diarrheagenic Escherichia Coli ◽  
Milk Samples ◽  
Cattle Feces ◽  
Eaec Strain

Abstract This study focused on detecting diarrheagenic Escherichia coli, enteropathogenic E. coli (EPEC), Shiga-toxin-producing E. coli (STEC), enterohemorrhagic E. coli (EHEC or STEC:EPEC), enterotoxigenic E. coli (ETEC), and enteroaggregative E. coli (EAEC) in raw milk, water, and cattle feces sampled from non-technified dairy farms located in the northeastern São Paulo State, Brazil. Thirty-six water samples were collected at different points, namely, water wells (8 samples), water intended for human consumption (8 samples), water from milking parlor (8 samples), and water intended for animal consumption (7 samples), headwaters (1 sample), rivers (3 samples), and reservoirs (1 sample). Three raw milk samples were taken directly from bulk tanks in each farm, totalizing 24 samples. Feces samples were collected using rectal swabs from 160 bovines (20 animals per farm). E. coli was detected in 128 feces samples (80%), 16 raw milk samples (66.67%), and 20 water samples (55.56%). STEC (26 samples, 16.25%), EPEC (10 samples, 6.25%), STEC: EPEC (5 samples, 3.13%), and STEC: ETEC (1 sample, 0.63%) were the most prevalent strains detected in samples from cattle feces. EPEC, STEC, and STEC: EPEC strains were detected in 4.17% (1 sample), 16.67% (4 samples), and 4.17% (1 sample) of raw milk samples, respectively. STEC strains were detected in water used in the milking parlor, while no EAEC strain was detected. As a conclusion, cattle feces are important contamination sources of pathogenic E. coli in non-technified dairy farms and, consequently, cross-contamination among feces, water, and/or raw milk can occur. The use of quality water and hygienic practices during milking are recommended to avoid contamination since pathogens can be transmitted to humans via raw milk or raw milk cheese ingestion.

scholarly journals Diversity, virulence and antibiogram traits of Escherichia coli recovered from potable water sources in Gharbia, Egypt

2020 ◽  
Vol 18 (3) ◽  
pp. 430-438
Author(s):  
Walid Elmonir ◽  
Etab Mohamed Abo Remela ◽  
Yasmine Alwakil
Keyword(s):  
Public Health ◽  
Escherichia Coli ◽  
Water Samples ◽  
Potable Water ◽  
Multiple Drug Resistance ◽  
Tap Water ◽  
Water Sources ◽  
Multiple Drug ◽  
Well Water ◽  
E Coli

Abstract This study aimed to assess the public health risk of coliforms and Escherichia coli contamination of potable water sources in Egypt. A total of 150 water samples (100 tap and 50 well) were collected from five districts in Gharbia governorate, Egypt. High rates of coliforms contamination were recorded in 52 and 76% of examined tap and well water samples, respectively. E. coli strains were detected in 16% of the water samples (15% tap water and 18% well water; 23.7% rural and 8.1% urban). Rural water sources were 3.5 times more likely to be contaminated than urban sources (P = 0.01). Eight (33.3%) E. coli isolates were Shiga toxin-producing E. coli (STEC). Multiple drug resistance (MDR) was observed for 62.5% of the isolates. Seven (29.2%) E. coli isolates harboured at least one of the extended-spectrum beta-lactamase (ESBL) genes. The majority (87.5%) of the STEC isolates were MDRs and harboured ESBL genes. STEC isolates were significantly more likely to resist six classes of antibiotics than non-STEC isolates. This is the first report of potable water contamination with MDR-STEC in Egypt. This study highlights an alarming public health threat that necessitates preventive interventions for public and environmental safety.

scholarly journals Membrane filtration media for the enumeration of coliform organisms and Escherichia coli in water: comparison of Tergitol 7 and lauryl sulphate with Teepol 610

1980 ◽  
Vol 85 (2) ◽  
pp. 181-191 ◽  
Author(s):  
Keyword(s):  
Escherichia Coli ◽  
Water Samples ◽  
False Positive ◽  
Membrane Filtration ◽  
Sodium Lauryl Sulphate ◽  
Standard Medium ◽  
E Coli ◽  
Laboratory Trial ◽  
Positive Results ◽  
Filtration Technique

SUMMARYIn a multi-laboratory trial with the mombrane filtration technique, three surfactants – Teepol 610 (T610), Tergitol 7 (T7) and sodium lauryl sulphate (LS) – were compared in media for the enumeration of coliform organisms and Escherichia coli in water. A total of 170 samples of water (87 raw and 92 marginally chlorinated) were examined for colony counts of coliform organisms, and 185 water samples (94 raw and 91 marginally chlorinated) for E. coli. Slight differences in the confirmed colony counts between the three media were noted, but few of these were observed consistently in every laboratory. In most laboratories, T7 gave slightly higher counts of E. coli than LS with chlorinated waters; a higher incidence of false-positive results for E. coli at 44 °C was also noted with T7. As there were no outstanding differences in the trial, sodium lauryl sulphate, which is chemically defined, cheap and readily available, is therefore recommended for use at a concentration of 0·1% instead of Teepol 610 in the standard medium for the enumeration of coliform organisms and E. coli in water by the membrane filtration technique.

Sign in / Sign up

Export Citation Format

Share Document