A Method for Authentication of Meat by PCR Amplification of Species-specific Markers of Mitochondrial Origin

2021 ◽  
Author(s):  
R. Thomas ◽  
M. Saikia ◽  
S. Singha ◽  
Z. Baruah ◽  
R. Kalita ◽  
...  
Keyword(s):  
Core Temperature ◽  
Pcr Amplification ◽  
Hot Water ◽  
Eastern Region ◽  
Meat Industry ◽  
Target Species ◽  
D Loop ◽  
Mitochondrial Origin ◽  
Meat Samples ◽  
Species Specific

Background: Adulteration of meat with their cheaper or inferior counterparts has become a common practice in the meat industry which threatens the feelings as well as the health of the people. Meat adulteration has issues relating to social, religious, economic, and public health. Therefore, it is important to develop simple and reliable techniques for the authentication of species of meat. Mitochondrial markers have been widely used in species identification and authentication as PCR of species-specific markers of mitochondrial origin is relatively rapid, accurate, sensitive and cost-effective as compared to other PCR based assays. The present study was carried out for authentication of raw and cooked meat from different species using PCR amplification of species-specific Cytb and D-loop markers of mitochondrial origin.Methods: In this study, detection of different raw meat viz. beef, carabeef, mutton, chevon, chicken, duck meat and dog meat as well as meat samples subjected to different processing temperatures was done using PCR of species-specific mitochondrial Cytb and D-loop markers. Samples of beef, carabeef, mutton, chevon, chicken, duck meat and dog meat were collected randomly from different locations of the North-Eastern region of India. The meat samples were subjected to heat treatment in hot water (80oC) to have 75oC core temperature. They were also cooked in steam to have the core temperature of 95oC. The samples were also subjected to autoclaving at a temperature of 121oC and 15 lb pressure. Result: The markers used in this study successfully amplified unique fragments for beef, carabeef, mutton, chevon, chicken, duck meat and dog meat. The sizes of the amplified products were 126 bp for beef, 226 bp for carabeef, 254 bp for mutton, 453 bp for chevon, 256 bp for chicken, 292 bp for duck meat and 100 bp for dog meat. The results were consistent in the meat samples which were subjected to different cooking temperatures ranging from 75-121oC. Consequently, these markers were validated for cross-amplification by checking them with other meat samples and no amplifications were observed in non-target species. The results suggested that all the markers were highly specific for the target species. The simplicity, sensitivity and stability of the assay indicated that this method could be very useful for meat authentication and thereby to detect adulteration. 

Defeating numts: Semi-pure mitochondrial DNA from eggs and simple purification methods for field-collected wildlife tissues

Genome ◽  
2006 ◽  
Vol 49 (11) ◽  
pp. 1438-1450 ◽  
Author(s):  
Gabriela Ibarguchi ◽  
Vicki L. Friesen ◽  
Stephen C. Lougheed
Keyword(s):  
Mitochondrial Dna ◽  
Gradient Methods ◽  
Pcr Amplification ◽  
Cesium Chloride ◽  
Pcr Cloning ◽  
Degenerate Primers ◽  
Purification Methods ◽  
Mitochondrial Origin ◽  
Reference Sequences ◽  
Species Specific

Mitochondrial DNA (mtDNA) continues to play a pivotal role in phylogeographic, phylogenetic, and population genetic studies. PCR amplification with mitochondrial primers often yields ambiguous sequences, in part because of the coamplification of nuclear copies of mitochondrial genes (numts) and true mitochondrial heteroplasmy arising from mutations, hybridization with paternal leakage, gene duplications, and recombination. Failing to detect numts or to distinguish the origin of such homologous sequences results in the incorrect interpretation of data. However, few studies obtain purified mtDNA to confirm the mitochondrial origin of the first reference sequences for a species. Here, we demonstrate the importance and ease of obtaining semi-pure mtDNA from wildlife tissues, preserved under various typical field conditions, and investigate the success of 3 commercial extraction kits, cesium-chloride gradient mtDNA purification, long-template PCR amplification, cloning, and more species-specific degenerate primers. Using more detailed avian examples, we illustrate that unfertilized or undeveloped eggs provide the purest sources of mtDNA; that kits provide an alternative to cesium-chloride gradient methods; and that long-template PCR, cloning, and degenerate primers cannot be used to produce reliable mitochondrial reference sequences, but can be powerful tools when used in conjunction with purified mtDNA stocks to distinguish numts from true heteroplasmy.

Quantitative Detection of Species-Specific DNA in Feedstuffs and Fish Meals

2005 ◽  
Vol 68 (6) ◽  
pp. 1217-1221 ◽  
Author(s):  
PAVEL KRCMAR ◽  
EVA RENCOVA
Keyword(s):  
Mitochondrial Dna ◽  
Real Time ◽  
Dna Sequences ◽  
Real Time Pcr ◽  
Single Species ◽  
Absolute Quantification ◽  
Quantitative Detection ◽  
Vertebrate Species ◽  
Target Species ◽  
Species Specific

A sensitive and rapid method for the quantitative detection of bovine-, ovine-, swine-, and chicken-specific mitochondrial DNA sequences based on real-time PCR has been developed. The specificity of the primers and probes for real-time PCR has been tested using DNA samples of other vertebrate species that may also be present in rendered products. The quantitative detection was performed with dual-labeled probes (TaqMan) using absolute quantification with external standards of single species meat-and-bone meals. This method facilitates the detection of 0.01% of the target species–derived material in concentrate feed mixtures and fish meals.

scholarly journals DNA-based species detection capabilities using laser transmission spectroscopy

2013 ◽  
Vol 10 (78) ◽  
pp. 20120637 ◽  
Author(s):  
A. R. Mahon ◽  
M. A. Barnes ◽  
F. Li ◽  
S. P. Egan ◽  
C. E. Tanner ◽  
...  
Keyword(s):  
Invasive Species ◽  
Dna Detection ◽  
Field Application ◽  
Economic Damage ◽  
Oligonucleotide Probes ◽  
Target Species ◽  
Dreissena Bugensis ◽  
Species Detection ◽  
Transmission Spectroscopy ◽  
Species Specific

Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel ( Dreissena bugensis ) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

ISSR-Derived Species-Specific SCAR Marker for Rapid and Accurate Authentication of Ocimum tenuiflorum L.

Planta Medica ◽  
2017 ◽  
Vol 84 (02) ◽  
pp. 117-122 ◽  
Author(s):  
Amit Kumar ◽  
Vereena Rodrigues ◽  
Priyanka Mishra ◽  
Kuppusamy Baskaran ◽  
Ashutosh Shukla ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
High Volume ◽  
Inter Simple Sequence Repeat ◽  
Rapid Identification ◽  
Medicinal Species ◽  
Accurate Identification ◽  
Sequence Characterized Amplified Region ◽  
Medicinal Value ◽  
Ocimum Tenuiflorum ◽  
Species Specific

Abstract Ocimum tenuiflorum has been widely used in traditional medicine and has high medicinal value. High volume trade of this potential medicinal plant species led to unscrupulous adulteration of both crude drugs as well as formulations. Morphology-based authentication is difficult in cases of incomplete or damaged samples and in dried herbal materials. In such cases, PCR-based molecular methods may aid in accurate identification. The present study aimed at developing species-specific DNA marker(s) for the authentication of O. tenuiflorum. A species-specific amplicon (279 bp) generated through an inter-simple sequence repeat marker (UBC 835) in all individuals of O. tenuiflorum was cloned, sequenced, and a primer pair was developed (designated as CIM-OT-835F/CIM-OT-835R). The newly developed sequence characterized amplified region marker was validated through PCR amplification in all available seven species of Ocimum, and its specificity for O. tenuiflorum was confirmed with the consistent generation of an amplicon of 177 bp. The developed marker can be used for accurate and rapid identification of the species for certification purposes and will be useful in quality control of medicinal preparations containing this important medicinal species.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Independent evolution of tetraloop in enterovirus oriL replicative element and its putative binding partners in protein 3C

2017 ◽  
Author(s):  
Maria A Prostova ◽  
Andrei A Deviatkin ◽  
Irina O Tcelykh ◽  
Alexander N Lukashev ◽  
Anatoly P Gmyl
Keyword(s):  
Amino Acid ◽  
Genome Stability ◽  
Rna Binding ◽  
Apical Region ◽  
Reading Frame ◽  
Loop Region ◽  
Binding Partners ◽  
D Loop ◽  
The One ◽  
Species Specific

Background. Enteroviruses are small non-enveloped viruses with (+) ssRNA genome with one open reading frame. Enterovirus protein 3C (or 3CD for some species) binds the replicative element oriL to initiate replication. The replication of enteroviruses features low fidelity, which allows the virus to adapt to the changing environment on the one hand, and requires additional mechanisms to maintain the genome stability on the other. Structural disturbances in the apical region of oriL domain d can be compensated by amino acid substitutions in positions 154 or 156 of 3C (amino acid numeration corresponds to poliovirus 3C), thus suggesting the co-evolution of these interacting sequences in nature. The aim of this work was to understand co-evolution patterns of two interacting replication machinery elements in enteroviruses, the apical region of oriL domain d and its putative binding partners in the 3C protein. Methods.To evaluate the variability of the domain d loop sequence we retrieved all available full enterovirus sequences (>6400 nucleotides), which were present in the NCBI database on February 2017 and analysed the variety and abundance of sequences in domain d of the replicative element oriL and in the protein 3C. Results.A total of 2,842 full genome sequences was analysed. The majority of domain d apical loops were tetraloops, which belonged to consensus YNHG (Y=U/C, N=any nucleotide, H=A/C/U). The putative RNA-binding tripeptide 154-156 (Enterovirus C 3C protein numeration) was less diverse than the apical domain d loop region and, in contrast to it, was species-specific. Discussion. Despite the suggestion that the RNA-binding tripeptide interacts with the apical region of domain d, they evolve independently in nature. Together, our data indicate the plastic evolution of both interplayers of 3C-oriL recognition.

scholarly journals Independent evolution of tetraloop in enterovirus oriL replicative element and its putative binding partners in protein 3C

2017 ◽  
Author(s):  
Maria A Prostova ◽  
Andrei A Deviatkin ◽  
Irina O Tcelykh ◽  
Alexander N Lukashev ◽  
Anatoly P Gmyl
Keyword(s):  
Amino Acid ◽  
Genome Stability ◽  
Rna Binding ◽  
Apical Region ◽  
Reading Frame ◽  
Loop Region ◽  
Binding Partners ◽  
D Loop ◽  
The One ◽  
Species Specific

Background. Enteroviruses are small non-enveloped viruses with (+) ssRNA genome with one open reading frame. Enterovirus protein 3C (or 3CD for some species) binds the replicative element oriL to initiate replication. The replication of enteroviruses features low fidelity, which allows the virus to adapt to the changing environment on the one hand, and requires additional mechanisms to maintain the genome stability on the other. Structural disturbances in the apical region of oriL domain d can be compensated by amino acid substitutions in positions 154 or 156 of 3C (amino acid numeration corresponds to poliovirus 3C), thus suggesting the co-evolution of these interacting sequences in nature. The aim of this work was to understand co-evolution patterns of two interacting replication machinery elements in enteroviruses, the apical region of oriL domain d and its putative binding partners in the 3C protein. Methods.To evaluate the variability of the domain d loop sequence we retrieved all available full enterovirus sequences (>6400 nucleotides), which were present in the NCBI database on February 2017 and analysed the variety and abundance of sequences in domain d of the replicative element oriL and in the protein 3C. Results.A total of 2,842 full genome sequences was analysed. The majority of domain d apical loops were tetraloops, which belonged to consensus YNHG (Y=U/C, N=any nucleotide, H=A/C/U). The putative RNA-binding tripeptide 154-156 (Enterovirus C 3C protein numeration) was less diverse than the apical domain d loop region and, in contrast to it, was species-specific. Discussion. Despite the suggestion that the RNA-binding tripeptide interacts with the apical region of domain d, they evolve independently in nature. Together, our data indicate the plastic evolution of both interplayers of 3C-oriL recognition.

scholarly journals Low-intensity exercise delays the shivering response to core cooling

2019 ◽  
Vol 316 (5) ◽  
pp. R535-R542 ◽  
Author(s):  
Tomomi Fujimoto ◽  
Bun Tsuji ◽  
Yosuke Sasaki ◽  
Kohei Dobashi ◽  
Yasuo Sengoku ◽  
...  
Keyword(s):  
Core Temperature ◽  
Thermal Sensation ◽  
Water Immersion ◽  
Hot Water ◽  
Temperature Threshold ◽  
Cool Water ◽  
Low Intensity ◽  
The Core ◽  
Core Cooling ◽  
Low Intensity Exercise

Hypothermia can occur during aquatic exercise despite production of significant amounts of heat by the active muscles. Because the characteristics of human thermoregulatory responses to cold during exercise have not been fully elucidated, we investigated the effect of low-intensity exercise on the shivering response to core cooling in cool water. Eight healthy young men (24 ± 3 yr) were cooled through cool water immersion while resting (rest trial) and during loadless pedaling on a water cycle ergometer (exercise trial). Before the cooling, body temperature was elevated by hot water immersion to clearly detect a core temperature at which shivering initiates. Throughout the cooling period, mean skin temperature remained around the water temperature (25°C) in both trials, whereas esophageal temperature (Tes) did not differ between the trials ( P > 0.05). The Tes at which oxygen uptake (V̇o2) rapidly increased, an index of the core temperature threshold for shivering, was lower during exercise than rest (36.2 ± 0.4°C vs. 36.5 ± 0.4°C, P < 0.05). The sensitivity of the shivering response, as indicated by the slope of the Tes-V̇o2 relation, did not differ between the trials (−441.3 ±177.4 ml·min−1·°C−1 vs. −411.8 ± 268.1 ml·min−1·°C−1, P > 0.05). The thermal sensation response to core cooling, assessed from the slope and intercept of the regression line relating Tes and thermal sensation, did not differ between the trials ( P > 0.05). These results suggest that the core temperature threshold for shivering is delayed during low-intensity exercise in cool water compared with rest although shivering sensitivity is unaffected.

scholarly journals Ultrastructural and biochemical analyses reveal cell wall remodelling in lichen-forming microalgae submitted to cyclic desiccation–rehydration

2019 ◽  
Vol 125 (3) ◽  
pp. 459-469 ◽  
Author(s):  
María González-Hourcade ◽  
Marcia R Braga ◽  
Eva M del Campo ◽  
Carmen Ascaso ◽  
Cristina Patiño ◽  
...  
Keyword(s):  
Cell Wall ◽  
Close Contact ◽  
Freeze Substitution ◽  
Water Soluble ◽  
Hot Water ◽  
Cell Shrinkage ◽  
Distinctive Features ◽  
Biochemical Analyses ◽  
Species Specific ◽  
Environmental Sem

Abstract Background and Aims One of the most distinctive features of desiccation-tolerant plants is their high cell wall (CW) flexibility. Most lichen microalgae can tolerate drastic dehydration–rehydration (D/R) conditions; however, their mechanisms of D/R tolerance are scarcely understood. We tested the hypothesis that D/R-tolerant microalgae would have flexible CWs due to species-specific CW ultrastructure and biochemical composition, which could be remodelled by exposure to cyclic D/R. Methods Two lichen microalgae, Trebouxia sp. TR9 (TR9, adapted to rapid D/R cycles) and Coccomyxa simplex (Csol, adapted to seasonal dry periods) were exposed to no or four cycles of desiccation [25–30 % RH (TR9) or 55–60 % RH (Csol)] and 16 h of rehydration (100 % RH). Low-temperature SEM, environmental SEM and freeze-substitution TEM were employed to visualize structural alterations induced by D/R. In addition, CWs were extracted and sequentially fractionated with hot water and KOH, and the gel permeation profile of polysaccharides was analysed in each fraction. The glycosyl composition and linkage of the main polysaccharides of each CW fraction were analysed by GC–MS. Key Results All ultrastructural analyses consistently showed that desiccation caused progressive cell shrinkage and deformation in both microalgae, which could be rapidly reversed when water availability increased. Notably, the plasma membrane of TR9 and Csol remained in close contact with the deformed CW. Exposure to D/R strongly altered the size distribution of TR9 hot-water-soluble polysaccharides, composed mainly of a β-3-linked rhamnogalactofuranan and Csol KOH-soluble β-glucans. Conclusions Cyclic D/R induces biochemical remodelling of the CW that could increase CW flexibility, allowing regulated shrinkage and expansion of D/R-tolerant microalgae.

Sign in / Sign up

Export Citation Format

Share Document