DDR1 may be a good biomarker for brain tumors.

2019 ◽  
Vol 37 (15_suppl) ◽  
pp. e13557-e13557
Author(s):  
Dilek Erdem ◽  
Mahmut Büyüksimsek ◽  
Meral Gunaldi ◽  
Nilgun Sahin
Keyword(s):  
Brain Tumor ◽  
Control Group ◽  
Tyrosine Kinase Receptor ◽  
Blood Levels ◽  
Blood Samples ◽  
Messenger Ribonucleic Acid ◽  
Central Nerve System ◽  
Tumor Tissues ◽  
Nerve System ◽  
And Control

e13557 Background: There are two important hardness in the treatment of central nerve system tumors; first of it is tumor heterogenity while the second is biomarker deficiency which can be target in the tumor tissue. For the reason we aimed to examine discoidin domain receptor (DDR1), a tyrosine kinase receptor , which may be thought to be effective in cell adhesion. Methods: 38 brain tumor were evaluated for tissue DDR1 messenger ribonucleic acid and blood DDR1 levels. We compared these with 10 control group tissue and blood levels of DDR1. Results: All brain tumor and control group tissues and blood samples were found DDR1 value positive. DDR1 levels of brain tumor tissues and blood samples were statistically higher when compared with DDR1 levels of control group tissue and blood samples. Conclusions: DDR1, found statistically higher among brain tumor tissues and blood samples may be a useful biomarker for the therapy and management of these patients.

scholarly journals Salmonella Bacterin Vaccination Decreases Shedding and Colonization of Salmonella Typhimurium in Pigs

2021 ◽  
Vol 9 (6) ◽  
pp. 1163
Author(s):  
Eduarda Alexandra Gonçalves de Oliveira Moura ◽  
Daniela Gomes da Silva ◽  
Caio Henrique Turco ◽  
Thainara Vitoria Carnevalli Sanches ◽  
Gabriel Yuri Storino ◽  
...  
Keyword(s):  
Salmonella Typhimurium ◽  
Blood Count ◽  
Control Strategies ◽  
Control Group ◽  
Blood Samples ◽  
Commercial Vaccine ◽  
Serum Igg ◽  
And Control ◽  
Experimental Group ◽  
Over Time

Since the occurrence of swine salmonellosis has increased over time and control strategies other than biosecurity are highly recommended, the present study aimed to evaluate the efficacy of vaccination with Salmonella Choleraesuis and Salmonella Typhimurium bacterins in pigs. Two experimental groups were formed: G1, animals immunized with two doses of a commercial vaccine (n = 20); G2, control group (n = 20). After vaccination, all pigs were orally challenged (D0) with 108 CFU of Salmonella Typhimurium and evaluated for 40 days. Every 10 days after D0, five piglets from each experimental group were euthanized and submitted to the necroscopic examination, when organ samples were collected. Blood samples and rectal swabs were collected before the first dose of the vaccine (D−42), before the second dose (D−21), before the challenge (D0), and thereafter, every three days until D39. Blood count, serum IgG measurement by ELISA, and the excretion of Salmonella Typhimurium in feces were evaluated. While the results from blood count and serum IgG concentration did not differ, the detection and excretion of Salmonella between G1 and G2 differed (p < 0.05). Therefore, it was observed that this vaccine partially protected the animals against experimental infection with Salmonella Typhimurium, reducing the excretion of bacteria in feces.

scholarly journals Effect of an extract of Aloe vera on the biodistribution of sodium pertechnetate (Na99mTcO4) in rats

2009 ◽  
Vol 24 (5) ◽  
pp. 383-386 ◽  
Author(s):  
Cecília Maria de Carvalho Xavier Holanda ◽  
Monique Batista da Costa ◽  
Natália Chilinque Zambão da Silva ◽  
Maurício Ferreira da Silva Júnior ◽  
Vanessa Santos de Arruda Barbosa ◽  
...  
Keyword(s):  
Aqueous Extract ◽  
Aloe Vera ◽  
Treated Group ◽  
Control Group ◽  
Blood Levels ◽  
Control Groups ◽  
High Increase ◽  
Tropical Plant ◽  
And Control ◽  
The Brain

PURPOSE: Aloe vera is a tropical plant popularly known in Brazil as babosa. We have investigated the effect of aqueous extract of Aloe vera on the biodistribution of Na99mTcO4 and laboratorial parameters in Wistar rats. METHODS: Twelve animals were divided into treated and control groups. In the treated group, Aloe vera was given by gavage (5mg/mL/day) during 10 days. The control group received sorbitol by the same way and period. One hour after the last dose, we injected 0.1mL of Na99mTcO4 by orbital plexus. After 60 min, all the animals were killed. Samples were harvested from the brain, liver, heart, muscle, pancreas, stomach, femur, kidneys, blood, testis and thyroid and the percentage of radioactivity (%ATI/g) was determined. Biochemical dosages were performed. RESULTS: There was a significant increase of %ATI/g in blood, femur, kidneys, liver, stomach, testis and thyroid and also in blood levels of AST and ALT. A significant decrease in levels of glucose, cholesterol, triglycerides, creatinine and urea occurred. The statistical analyses were performed by Mann-Whitney test and T-Student test (p<0.05). CONCLUSION: The aqueous extract of Aloe vera facilitated the uptake of Na99mTcO4 in organs of rats and it was responsible to a high increase of levels of AST and ALT.

scholarly journals Study the Oxidative Stress, Some Biochemical and Hematological Parameters in patients with agout at AL-Ramadi city

2016 ◽  
Vol 13 (4) ◽  
pp. 694-701
Author(s):  
Baghdad Science Journal
Keyword(s):  
Blood Cells ◽  
Hematological Parameters ◽  
Age Groups ◽  
Control Group ◽  
Enzymatic Antioxidants ◽  
Blood Picture ◽  
Control Groups ◽  
Blood Samples ◽  
Normal Individuals ◽  
And Control

This study aims to study the effect of gout disease on complete blood picture and biochemical parameters and some non-enzymatic antioxidants, some tracing elements and lipid peroxidation ,in outpatients with gout disease at Al-Ramadi Teaching-Hospital ,Al-Razi Hospital and the study duration from Octo.2013-to May 2014.(50) blood samples were collected from patients with age groups (30-80 years) from both sexes (28 males,22 females),a (30) blood samples (15 males,15 females) were collected from normal individuals as a control group with age groups (27-75 years). Hematological measurement showed no significant differences in size compressed blood cells, the percentages in ( 45.15 +4.99 and 46.87+6.30) % in patient and control groups respectively, hemoglobin concentrations were ( 14.04+1.66 and 14.30+1.93) g/l in patient and control groups respectively, total number of red blood cells ( 5.21+0.43 and 5.12 +0.58) 106/mm3 in patient and control groups respectively with(P?0.05) in ESR (21.06+13.47 and 13.37 +7.45) mm/hr in patient and control groups respectively with (P?0.05), the total number of WBCs were recorded (8.96+2.04 and 7.50+1.69)in patient and control groups respectively. Results showed also significant differences (P?0.05) in uric acid levels (7.42+0.76 and 5.62+0.88) mg/dl,malondialdehyde levels were recorded (4.45+0.64 and 3.21+0.86) in patient and control groups

scholarly journals Herb-Drug Interaction: Effects of Relinqing® Granule on the Pharmacokinetics of Ciprofloxacin, Sulfamethoxazole, and Trimethoprim in Rats

2016 ◽  
Vol 2016 ◽  
pp. 1-6 ◽  
Author(s):  
Yuan Lu ◽  
ZiPeng Gong ◽  
YuMin Xie ◽  
Jie Pan ◽  
Jia Sun ◽  
...  
Keyword(s):  
Drug Interaction ◽  
Pharmacokinetic Parameters ◽  
Control Group ◽  
Urinary System ◽  
Blood Samples ◽  
Sd Rats ◽  
Chinese Patent ◽  
Group 2 ◽  
And Control ◽  
Group 1

Relinqing granule (RLQ) is the best-selling Chinese patent drug for treatment of urinary system diseases. In this study, the effects of RLQ on the pharmacokinetics of ciprofloxacin, sulfamethoxazole, and trimethoprim in SD rats were investigated. Rats were randomly divided into control group 1, control group 2, RLQ group 1, and RLQ group 2. RLQ group 1 and RLQ group 2 were treated orally with RLQ for 7 days, and rats were treated with the same volume of water in control group 1 and control group 2. Then, RLQ group 1 and control group 1 were given intragastrically ciprofloxacin on day 8, while RLQ group 2 and control group 2 were given intragastrically sulfamethoxazole and trimethoprim on day 8. Blood samples were collected and determined. There was no significant influence of pharmacokinetic parameters of trimethoprim on two groups. But some pharmacokinetic parameters of ciprofloxacin and sulfamethoxazole in RLQ pretreated rats were evidently altered (P < 0.05), which indicated that absorption of ciprofloxacin and sulfamethoxazole in RLQ pretreated rats was significantly affected. It indicated the coadministration of RLQ would have an influence on the efficacy of ciprofloxacin and sulfamethoxazole, and the doses of ciprofloxacin tablet and compound sulfamethoxazole tablet need adjustment.

Diagnostic Role Of MPV In Acute Appendicitis

2020 ◽  
pp. 10-13
Author(s):  
◽  
Keyword(s):  
Acute Appendicitis ◽  
Mean Platelet Volume ◽  
Pathological Diagnosis ◽  
Control Group ◽  
Healthy Children ◽  
Platelet Volume ◽  
Blood Samples ◽  
Diagnostic Role ◽  
And Control

Introduction: The aim of this study was to investigate the diagnostic role of mean platelet volume (MPV) for acute appendicitis. Methods: Patient files were retrospectively observed. MPV of 311 patients with pathological diagnosis of acute appendicitis were compared with the MPV of 314 healthy children (blood samples were taken for elective operations). SPSS (IBM SPSS Statistics for Windows, Version 20.0. Armonk, NY: IBM Corp.) was used to evaluate the results. Results: 188 of acute appendicitis were male (%60.5). Mean age of acute appendicitis group was 10.22±3.83. MPV of children with the diagnosis of acute appendicitis (8.37±0.83fL) and the control group (10.55±0.83fL). MPV values were statistically different between the acute appendicitis and control group (p<0,001). Conclusion: MPV may be used as a marker for the diagnosis of acute appendicitis, but it is not a specific biomarker for appendicitis.

Interferon Gamma +874A/T Polymorphism in Children with Idiopathic Thrombocytopenic Purpura

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 4539-4539
Author(s):  
Fatih Demircioglu ◽  
Hale Ören ◽  
Sefa Kizildag ◽  
Sebnem Yilmaz ◽  
Berna Atabay ◽  
...  
Keyword(s):  
Allele Frequency ◽  
Interferon Gamma ◽  
Gene Polymorphisms ◽  
Statistical Difference ◽  
Control Group ◽  
Blood Samples ◽  
Chronic Itp ◽  
Significant Difference ◽  
Acute Itp ◽  
And Control

Abstract A recent study showed that expression of Toll-like receptor and interferon-gamma associated genes is significantly increased in patients with chronic ITP. Interferon-gamma is an important protein which takes place in immunoregulation. +874A/T polymorphism in the first introne of interferon gamma gene is found to be associated with the development and clinical phenotype of some autoimmune diseases such as diabetes mellitus, thyroiditis, multiple sclerosis, and SLE. The aim of our study was to investigate whether interferon gamma +874A/T polymorphism is a risk factor for the development of ITP and whether it affects the clinical course and response to the treatment. Thirty five children with acute ITP and 40 children with chronic ITP who were followed for at least 6 months were included. Control group consisted 90 healthy children. Two millilitres of blood sample was taken into sterile tubes containing 0.1% EDTA from each child and all blood samples were stored at −20 until analysis. DNA was isolated from blood samples and interferon gamma +874A/T polymorphism was studied with real-time PCR and LightCycler TM. Twenty one patients had AA, 35 patients had AT, and 19 patients had TT genotype. In the control group, 47 children had AA, 36 children had AT, and 7 children had TT genotype. There was a statistical difference between ITP and control group regarding the genotype (p=0.001). The frequency of A and T alleles in ITP group was 52% and 48%, respectively. The frequency of A and T alleles in control group was 72.7% and 27.8%, respectively. The frequency of allele distribution was statistically different between the ITP and control groups (p&lt;0.0001). There was a statistical significant difference between acute ITP and control group regarding the frequency of AA, AT, and TT gene polymorphisms and allele frequency (p=0.002, p=0.002). Similarly, there was a statistical significant difference between chronic ITP and control group regarding the frequency of AA, AT, and TT gene polymorphisms and allele frequency (p=0.008, p=0.002). The frequency of AA, AT, and TT gene polymorphisms and allele frequency showed no statistical difference between acute and chronic ITP groups (p=0.285, p=0.896). There was no correlation between interferon gamma +874A/T polymorphism and severity of bleeding (mild, moderate and severe) (p=0.09). There was no correlation between interferon gamma +874A/T polymorphism and response to long term treatment in patients with chronic ITP (p=0.568). In conclusion, there was a significant difference between patients with ITP and children in control group regarding interferon gamma +874A/T polymorphism and in the light of recent data involving other autoimmune disorders, we think that interferon gamma +874A/T polymorphism may be a risk factor for ITP.

scholarly journals Comparative Study of Vitamin C on Serum Lipid Profile in Healthy Male and Female Human Subjects

2012 ◽  
Vol 4 (3) ◽  
pp. 775-781 ◽  
Author(s):  
G. S. Gaur ◽  
A. K. Dixit
Keyword(s):  
Vitamin C ◽  
Lipid Profile ◽  
Ldl Cholesterol ◽  
Human Subjects ◽  
Test Group ◽  
Control Group ◽  
Blood Samples ◽  
Male And Female ◽  
Vitamin C Supplementation ◽  
And Control

This study aims to assess the comparative effects of vitamin C supplementation on lipid profiles in male and female human subjects. A total of 60 healthy individuals (male and female) were selected randomly, instructed and given the understanding of the purpose of study. The test group comprising  30 individuals  were given 500mg vitamin C tablets one daily for 30 days and control group of 30 individuals were given placebo capsules(glucose 500mg)  one daily for 30 days. Fasting blood samples were collected in the morning for estimation of cholesterol, triglycerides, HDL-C, LDL-C and VLDL-C on first day of the commencement of the study and second blood samples were taken after thirty days of supplementation and same estimations were carried out. Vitamin C caused reduction in serum total cholesterol and LDL cholesterol significantly but it did not have any statistically significant effect on HDL-C, VLDL-C and triglycerides. As far as gender is concerned the effect of vitamin C on lipid profile in males was not significantly different from those in females.© 2012 JSR Publications. ISSN: 2070-0237 (Print); 2070-0245 (Online). All rights reserved.doi: http://dx.doi.org/10.3329/jsr.v4i3.8894 J. Sci. Res. 4 (3), 775-781 (2012)

scholarly journals Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride

2021 ◽  
Vol 41 ◽  
pp. 06003
Author(s):  
Lu’lu’ Sahara Wusahaningtyas ◽  
Moh Mirza Nuryady ◽  
Lintang Winantya Firdausy ◽  
Ahmad Fahrurrozi Zs ◽  
R. Wisnu Nurcahyo
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Abc Transporters ◽  
Trypanosoma Evansi ◽  
Control Group ◽  
Transporter Gene ◽  
High Similarity ◽  
Blood Samples ◽  
Multiple Alignments ◽  
And Control

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.

scholarly journals Effect of Administration of Single Dose GnRH Agonist in Luteal Phase on Implantation Rate of Fresh ICSI Cycles

2021 ◽  
Vol 10 (2) ◽  
pp. 1-14
Author(s):  
Sally Alaa ◽  
Nadia Al-Hilli ◽  
Mufeda Jwad
Keyword(s):  
Gnrh Agonist ◽  
Luteal Phase ◽  
Implantation Rate ◽  
Control Group ◽  
Blood Levels ◽  
Control Groups ◽  
Cleavage Rate ◽  
And Control ◽  
Implantation And Pregnancy Rates ◽  
Metaphase Ii Oocytes

The luteal phase (LP) in the fresh ICSI cycle is insufficient, adequate LP support is one of the approved treatments for improving implantation and pregnancy rates. It is generally known that the LP is inadequate after ovarian stimulation due to negative from supra-physiological blood levels of steroids released by numerous corporal luteal, LH concentrations are low during the luteal phase. In this study, patients were divided into two groups: (40) patients as study group; those who received GnRHa (Decapeptil 0.1 mg), three days after embryo transfer, in addition to conventional luteal phase support (LPS) in the LP to increase the implantation and pregnancy rate in IVF; and their control group (40) received standard LPS only. On the second day of stimulation, blood samples for FSH, LH, TSH, E2, and prolactin were taken. On the day of ovulation induction, measure E2, progesterone, and LH; and on the day of embryo transfers, measure progesterone and LH. The overall characteristics of the patients in both groups were not significantly different. There was also no significant change in the number of total oocytes, mean of metaphase II oocytes percent, cleavage rate, grade I embryo percent, or serum hormones level between the study and control groups (p > 0.05). GnRH agonist treatment in the luteal phase improves clinical pregnancy and implantation rate in fresh ICSI cycles but is not statistically significant.

Different wavelengths of light on GnRH mRNA, LH, steroid hormones and egg lay in the ageing hens (Gallus gallus domesticus).

2016 ◽  
Vol 5 (06) ◽  
pp. 4597
Author(s):  
Janardhan Reddy Ippala* ◽  
Ashish Mishra ◽  
Mondal S. ◽  
David G. C. ◽  
Ravi Kiran G. ◽  
...  
Keyword(s):  
Steroid Hormones ◽  
Egg Production ◽  
Treated Group ◽  
Reproductive Period ◽  
Control Group ◽  
Blood Samples ◽  
Egg Formation ◽  
High Concentrations ◽  
Normal Spectrum ◽  
And Control

The aim of this study was to investigate the effects of red spectrum of light (650nm, treated n=12) and normal spectrum of light (450nm control=12) on circulating concentrations of luteinizing hormone (LH), progesterone (P4), estradiol (E2β), GnRH mRNA, pause days and egg production in birds later in the reproductive period from 92-102weeks of age. Twenty-four White Leghorn birds of same age group were divided into two groups of 12 in each as control and treated. Birds in the control group were exposed to normal spectrum of light (450nm of length) and birds in the treated group were exposed to red spectrum of light (650nm, treated n=12). Egg production and inter sequence pauses were recorded daily from both the groups. Plasma LH, E2β and P4 concentrations were estimated in blood samples collected at weekly intervals. At 97th weeks of age, blood samples from treated and control birds were obtained every 3 h for 36 h to study the surges of LH. It was found that plasma GnRH was higher (p < 0. 01) in treated birds with high concentrations of LH, its 3 h LH surges, E2β and P4 in plasma. Higher egg production, less pause days in treated birds may be the result of high GnRH associated with positively correlated responses of high concentrations of LH (with regular interval and duration of LH surges), E2β and P4 concentration required for completion of egg formation and oviposition. In conclusion, red spectrum of light enhanced GnRH mRNA (p < 0. 01), increased (p < 0. 01) steroid hormones and LH surges, for egg formation and oviposition and enabled the birds to lay more eggs even later in the productive period with the available resources under normal husbandry practices. 

Sign in / Sign up

Export Citation Format

Share Document