Isolation of pathogenic bacteria from Oberea linearis (Coleptera: Cerambycidae)

Biologia ◽  
2007 ◽  
Vol 62 (1) ◽  
Author(s):  
Ali Bahar ◽  
Zihni Demirbağ
Keyword(s):  
Serratia Marcescens ◽  
Pseudomonas Syringae ◽  
Pathogenic Bacteria ◽  
Bacterial Flora ◽  
Biochemical Properties ◽  
Metabolic Enzyme ◽  
Rrna Gene ◽  
Pseudomonas Sp ◽  
Bacterial Isolates ◽  
Enterobacter Agglomerans

AbstractThe bacterial flora of the Oberea linearis (Coleoptera: Cerambycidae) was investigated and 13 different bacteria were isolated from O. linearis larvae. Seven of these bacteria were performed and characterized at species level and the rest of them were characterized at genus level. In this study, we determined morphological and physiological characteristics of the bacterial isolates by conventional and routine techniques, biochemical properties and metabolic enzyme profiles by API20E and Phoenix 1000A panel test systems. Additionally, 16S rRNA gene sequence analysis was also performed to identify the isolates at the molecular level. The isolates were identified as Acinetobacter calcoaceticus (Ol1), Enterobacter aerogenes (Ol2), Pseudomonas sp. (Ol3), Flavobacterium sp. (Ol4), Microbacterium sp. (Ol5), Enterobacter agglomerans (Ol6), Xanthomonas sp. (Ol7), Pseudomonas syringae (Ol8), Pseudomonas sp. (Ol9), Xanthomonas sp. (Ol10), Enterobacter cancerogenus (Ol11), Xanthomonas maltophilia (Ol12), and Serratia marcescens (Ol13). This is the first record of bacterial isolates (Ol5, Ol8, Ol11, Ol12) from any insect. All these bacteria were tested against O. linearis larvae, and Serratia marcescens was found to cause the highest mortality (65%). On the other hand, we determined 90% mortality against this pest within four days by utilizing spore and crystal mixture of Bacillus thuringiensis isolated from Melolontha melolontha.

scholarly journals Endophytic Bacteria from Faloak Plant Seed (Sterculia comosa Wallich) as Antibacterial Agent

2018 ◽  
Vol 10 (3) ◽  
pp. 546-552
Author(s):  
Maria Yasinta Moi ◽  
Endang Kusdiyantini ◽  
Sri Pujiyanto
Keyword(s):  
Antibacterial Agent ◽  
Endophytic Bacteria ◽  
Pathogenic Bacteria ◽  
Inhibition Zone ◽  
Biochemical Properties ◽  
Rrna Gene ◽  
Plant Seed ◽  
E Coli ◽  
Antibiotic Compounds ◽  
Screening Result

Endophytic bacteria isolated from some various kind of plants are able to yield some active compounds which have a role as an antibacterial compound. This work aimed to isolate and to screen the Endophytic bacteria from Faloak seed in its charge in inhibiting two kinds of pathogenic bacteria, Staphylococcus aureus and Escherichia coli. There were six isolates of Endophytic bacteria isolated in this work. According to the screening result, one isolate which had the most potential antibacterial activity (marked by the formation of inhibition zone) against S. aureus and E. coli. That most potential isolate was then tested and identified for both biochemical properties and molecular 16S rRNA gene. The result of this study showed that the endophytic bacteria isolate of Faloak seed with the code of S1 had the similarity with Enterobacter xiangfangensis strain 10-17 by 93 %. The research about endophytic bacteria of Faloak plants was never conducted before. Thus this research was expected to give information about the potential of antimicrobial ability Faloak plants which can be utilized in the discovery of new antibiotic compounds which in the future are expected to overcome the problem of microorganism resistance to antibiotics. The use of endophytic bacteria is expected to prevents the extinction of Faloak plants due to excessive use.

scholarly journals Apis andreniformis associated Actinomycetes show antimicrobial activity against black rot pathogen (Xanthomonas campestris pv. campestris)

PeerJ ◽  
2021 ◽  
Vol 9 ◽  
pp. e12097
Author(s):  
Yaowanoot Promnuan ◽  
Saran Promsai ◽  
Wasu Pathom-aree ◽  
Sujinan Meelai
Keyword(s):  
Antimicrobial Activity ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Honey Bee ◽  
Pseudomonas Syringae ◽  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Rrna Gene ◽  
Apis Andreniformis

This study aimed to investigate cultivable actinomycetes associated with rare honey bee species in Thailand and their antagonistic activity against plant pathogenic bacteria. Actinomycetes were selectively isolated from the black dwarf honey bee (Apis andreniformis). A total of 64 actinomycete isolates were obtained with Streptomyces as the predominant genus (84.4%) followed by Micromonospora (7.8%), Nonomuraea (4.7%) and Actinomadura (3.1%). All isolates were screened for antimicrobial activity against Xanthomonas campestris pv. campestris, Pectobacterium carotovorum and Pseudomonas syringae pv. sesame. Three isolates inhibited the growth of X. campestris pv. campestris during in vitro screening. The crude extracts of two isolates (ASC3-2 and ASC5-7P) had a minimum inhibitory concentration (MIC) of 128 mg L−1against X. campestris pv. campestris. For isolate ACZ2-27, its crude extract showed stronger inhibitory effect with a lower MIC value of 64 mg L−1 against X. campestris pv. campestris. These three active isolates were identified as members of the genus Streptomyces based on their 16S rRNA gene sequences. Phylogenetic analysis based on the maximum likelihood algorithm showed that isolate ACZ2-27, ASC3-2 and ASC5-7P were closely related to Streptomyces misionensis NBRC 13063T (99.71%), Streptomyces cacaoi subsp. cacaoi NBRC 12748T (100%) and Streptomyces puniceus NBRC 12811T (100%), respectively. In addition, representative isolates from non-Streptomyces groups were identified by 16S rRNA gene sequence analysis. High similarities were found with members of the genera Actinomadura, Micromonospora and Nonomuraea. Our study provides evidence of actinomycetes associated with the black dwarf honey bee including members of rare genera. Antimicrobial potential of these insect associated Streptomyces was also demonstrated especially the antibacterial activity against phytopathogenic bacteria.

scholarly journals Sensitivity of Heterotrophic Bacteria in the Low-Salinity Water Areas and Estuary in Siak District toward Pathogenic Bacteria in Fish

2019 ◽  
Vol 2019 ◽  
pp. 1-8
Author(s):  
F. Feliatra ◽  
Rizki Hamdani ◽  
Iesye Lukystyowati ◽  
Irvina Nurachmi
Keyword(s):  
Aeromonas Hydrophila ◽  
Pathogenic Bacteria ◽  
Heterotrophic Bacteria ◽  
Vibrio Alginolyticus ◽  
High Rate ◽  
Nucleotide Sequencing ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Phylogenetic Structure ◽  
Bacterial Diseases

The high rate of bacterial diseases in fishes and shrimps has lead scientists seek for natural antibiotic products that would act as a solution. An example of this product is the secondary metabolic products from heterotrophic bacteria. These bacteria could easily be found in many water regions and estuaries, including the Siak District, Riau, Indonesia. Therefore, this study aims at determining the ability of bacterial isolates in inhibiting the growth of pathogens (Vibrio alginolyticus, Aeromonas hydrophila, and Pseudomonas sp.). The research was conducted from June to September 2018. It actuates the type of heterotrophic bacteria in the sampling area using the PCR technique. The phylogenetic structure of bacterial isolates obtained during this study was assessed by nucleotide sequencing of the 16S rRNA gene. The antagonism test showed that bacteria had the ability to inhibit the growth of pathogens (Vibrio alginolyticus, Aeromonas hydrophila, and Pseudomonas sp.). The results showed that 25 pure bacterial isolates were obtained, in which 10 of those were carried out by DNA sequencing; hence, it could be used as antimicrobes. Based on the analysis of 16S rDNA, 10 isolates were identified: 6 were Bacillus cereus and 2 were Pseudomonas aeruginosa with homology levels ranging from 97 to 99%, while the remaining two were suspected as the new species of isolates. From the result, it could be concluded that heterotrophic bacteria are found to be better used as antipathogens against Vibrio alginolitycus than hydrophila and Pseudomonas sp.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals Antimicrobial activity evaluation of frankincense oil in domestic water samples by 16s rRNA gene

2017 ◽  
Vol 2 (4) ◽  
Author(s):  
Saeed F R ◽  
Al Kendi R ◽  
Vijith Chandu
Keyword(s):  
Antimicrobial Activity ◽  
Bacterial Species ◽  
Water System ◽  
Morphological Characteristics ◽  
Rrna Gene ◽  
Water Tank ◽  
Pseudomonas Sp ◽  
Bacterial Isolates ◽  
Domestic Water ◽  
Minimum Effective Concentration

          The domestic water system permits the growth and reproduction of bacterial species. The removal of such contaminants by the application of chemical disinfectants like chlorine may pose health risk. Therefore, the natural products are more favored to be investigated for its antimicrobial activity. The current study investigates the efficiency of frankincense oil as an antimicrobial agent on bacterial species isolated from the domestic water system. In the previous study, 15 bacterial species were isolated based on the colony morphological characteristics and prepared for identification. 16S rDNA gene was amplified using PCR for all bacterial isolates followed by sequencing and identification using BLAST.  Thirteen bacterial isolates were identified and represented in Staphylococcus saprophhyticus, Bacillus pumilus, Bacillus safensis and Pseudomonas sp. and the last one showed more resistant to frankincense oil as the numbers increased with the treatment by 26% and 35%. Other species were either completely or partially eliminated. The results confirmed that the antimicrobial activity of frankincense oil against some bacterial species, mainly exist in storage tank. Pseudomonas sp. showed resistance to frankincense oil (10%) used in this study. In addition, Staphylococcus saprophhyticus is of a concern to human health, however, it showed sensitivity to frankincense oil and also, its presence in the water tank indicates hygiene issues of the household. The frankincense oil found to be a promising disinfectant, thus further analysis needed to specify the minimum effective concentration to be applied, also to find out whether it is cost effective to be used as a disinfectant.

scholarly journals Diversity of Biofilm-Forming Bacteria in Chinnamuttom Harbor of Southeast India

2021 ◽  
Vol 14 (4) ◽  
pp. 1793-1799
Author(s):  
P. Nithya
Keyword(s):  
Surface Water ◽  
Bacterial Species ◽  
Ship Hull ◽  
Rrna Gene ◽  
Pseudomonas Sp ◽  
Bacillus Sp ◽  
Bacterial Isolates ◽  
Four Seasons ◽  
The Mean ◽  
Marine Environmental

Biofilms are species rich, partially due to highly effective powers of diffusion of the microorganisms and have wide tolerance to marine environmental conditions. Characteristically, the first organisms to respond to and convalesce from stress. The present study aims to isolate and identify the biofilm forming bacterial species, collected from surface water and substratum of the ship hull for four seasons at Chinnamuttom fishing harbor, Southeast coast of India, during June 2015 to May 2016. Among the mean concentration of bacterial isolates of both water and substratum of the station, maximum in monsoon and minimum in summer seasons. Totally 16 isolates were obtained, based on the adherence property, 8 isolates from surface water and 8 isolates from substratum of the ship hull. The samples were plated on Zobell marine agar medium for bacterial isolates of study area. The isolates of Bacillus sp., Flavobacterium sp., Pseudomonas sp., Aeromonas sp., Micrococcus sp., Vibrio sp., Salmonella sp., Staphylococcus sp., Shegella sp., Klebsiella sp., Corynebacterium sp., Enterobacter sp., Chromohalobacter sp., Bacillus sp., Escherichia coli and Bacilus sp. were reported in all the seasons at study area. The major diverse bacterial isolates were further characterized through morphological and molecular identification. Based on 16S rRNA gene sequences. Biofilm bacterial isolates were confirmed as Bacillus sp., and Pseudomonas sp.

Antagonistic activity of marine bacterial isolates on common human pathogenic bacteria

2017 ◽  
Vol 1 (2) ◽  
Author(s):  
Mukesh Pimpliskar ◽  
Priyanka Pagare ◽  
Rahul Jadhav
Keyword(s):  
Pathogenic Bacteria ◽  
Antibiotic Production ◽  
Bacterial Flora ◽  
Inhibitory Effect ◽  
Antagonistic Activity ◽  
Marine Animal ◽  
Bacterial Isolates ◽  
Human Pathogens ◽  
Candida Sp ◽  
Pathogenic Organisms

Antagonistic activity of marine bacteria against common human pathogens was studied in this project. Marine animal surface bacterial flora was isolated from selected animal collected from local fishermen. The sample bacteria were isolated by serial dilution followed by spread plate method using marine agar (ZMA). About 11 bacterial isolates were selected and screened for antimicrobial activity through agar well diffusion assay. Among 11 isolates, 7 isolates exerted an inhibitory effect against human pathogenic organisms (E.coli, S.aureus, Klebsiella and Candida sp.). The isolates were then investigated for antibiotic production by cross species signal transfer mediated induction, 2 isolates (Sh-2 and PJR-3) exhibited enhanced activity against human pathogenic organisms (E.coli, S.aureus and Candida sp.). These 2 isolates were characterized phenotypically by morphological techniques (which revealed the strains as gram-positive and gram negative respectively) and physiologically by conventional tests. 

Optimization of Myo-inositol hexakisphosphate phosphohydrolase (MIPH) production and enhancement of hydrocarbons degradation by purified MIPH

2021 ◽  
Vol 26 (1) ◽  
pp. 2236-2243
Author(s):  
HUACHENG TANG ◽  
DONGJIE ZHANG ◽  
CHANGYUAN WANG ◽  
ZHIJIANG LI
Keyword(s):  
Serratia Marcescens ◽  
High Specificity ◽  
Growth Conditions ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Polluted Soils ◽  
Inositol Hexakisphosphate ◽  
Zone Formation ◽  
Similar Activity ◽  
The 16S Rrna Gene

Objective: The present study characterizes bacteria with biodegradation ability and optimize the growth conditions of Myo-inositol hexakisphosphate phosphohydrolase (MIPH). Methods: Out of the 15 bacterial isolates, one strain SM01 showed the highest MIPH activity was selected based on the diameter of halo zone formation on calcium phytate plates. SM01 strain was identified as a Serratia marcescens with the highest phytate activity which was further confirmed by partial sequencing of the 16S rRNA gene. Results: MIPH enzyme was purified from Serratia strain which was found to exhibit a highly-specific MIPH activity and high specificity to the phytic acid but negligible activity against the other substrates tested. The purified MIPH enzyme had an isoelectric point of 6.8 and Molecular weight to 60 kDa. The degradative ability of Serratia marscescens shown that both the culture and the purified enzyme had maximum MIPH activity at the 36 h of incubation. 0.5 U/ml concentration of the purified MIPH enzyme was found to show similar activity as the 108 cfu/ml culture tested. Conclusion: Serratia marcescens SM01 strain was capable of degrading hydrocarbons due to their varied strategies to produce the MIPH enzyme. This could be made useful in the biodegradation of polluted soils and the environment.

scholarly journals Bacterial isolates from bryozoan Pleurocodonellina sp.: Diversity and antimicrobial potential against pathogenic bacteria

2019 ◽  
Vol 20 (9) ◽  
Author(s):  
Meezan Ardhanu Asagabaldan ◽  
Gilles Bedoux ◽  
Nathalie Bourgougnon ◽  
Rhesi Kristiana ◽  
Diah Ayuningrum ◽  
...  
Keyword(s):  
Pathogenic Bacteria ◽  
16S Rrna Gene Sequencing ◽  
Antibacterial Activities ◽  
Multidrug Resistant ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Bacterial Strains ◽  
Associated Bacteria ◽  
Antimicrobial Potential ◽  
Rrna Gene Sequencing

Abstract. Asagabaldan MA, Bedoux G, Bourgougnon N, Kristiana R, Ayuningrum D, Sabdono A, Trianto A, Radjasa OK. 2019. Bacterial isolates from bryozoan Pleurocodonellina sp.: Diversity and antimicrobial potential against pathogenic bacteria. Biodiversitas 20: 2528-2535.  There is an urgent need to discover new compounds with antibacterial activity, which can be developed into lead structures for the treatment of human disease caused by multidrug-resistant (MDR) bacteria. In this study, we focussed on bryozoan-associated bacteria to screen them toward antibacterial activities, since the microbiome of these organisms can still be regarded as under-investigated. Most of the few publications about bryozoan-associated bacteria focused on taxonomy and the potential as producers of antibacterial natural products were neglected. Four specimens of bryozoan Pleurocodonellina sp. were collected from Teluk Awur, Jepara in Java Sea, Indonesia. Therefrom, 56 bacterial strains were isolated, and 17 displayed antibacterial activities against MDR bacteria Pseudomonas aruginosa, Klebsiella pneumoniae, Acinetobacter baumannii, Enterobacter cloacae, and methicillin-resistant Staphylococcus aureus (MRSA). Taxonomic identification of the bacteria by 16S rRNA gene sequencing revealed them belonging to the genera Virgibacillus, Pseudoalteromonas, Halomonas, and Bacillus. Most interestingly, the genus Virgibacillus was dominantly obtained from the Pleurocodonellina sp. specimens, i.e., 12 active isolates. Nevertheless, the best activities against MDR bacteria (both Gram-positive and Gram-negative) were contributed to isolates showing >99% identity to Pseudoalteromonas. The results further suggest adding the genus Virgibacillus as bacteria associated with bryozoan, since to the best of our knowledge there were no reports of this genus isolated from bryozoan.

scholarly journals BAKTERI PATOGEN PADA KEPITING KELAPA (Birgus latro)

2021 ◽  
Vol 8 (1) ◽  
pp. 57
Author(s):  
Muhammad Aris ◽  
Sudirto Malan
Keyword(s):  
Pathogenic Bacteria ◽  
Biochemical Characterization ◽  
Economic Value ◽  
Pseudomonas Sp ◽  
Bacterial Isolates ◽  
Fishery Resource ◽  
Colony Type ◽  
Coastal Plants ◽  
The World ◽  
Steep Slopes

Coconut crab (Birgus latro) is a fishery resource with high economic value. Coconut Crab is only found in eastern Indonesia, covering Sulawesi, Maluku and North Maluku. One of the habitat of Coconut Crab in North Maluku is Moor Island, Central Halmahera. The coastal typology of this island is predominantly rocky with many gaps and small caves, as well as several steep slopes with dominant vegetation conditions of coconut, beach pandanus and other coastal plants. Walnut Crab is often used as a consumption ingredient because it has delicious taste and high nutritions. However, the use of crustaceans for consumption can also be dangerous. This is because crustaceans also contain several pathogenic bacteria. This study aimed to identify pathogenic bacteria isolated from Coconut Crab which is the largest crustacean in the world. 5 samples of Coconut Crab were taken from Moor Island. Isolated samples marked KK1, KK2, KK3, KK4 and KK5. Pure bacterial isolates were obtained from Coconut Crab samples, evaluated for colony type and identified based on biochemical characterization. The types of pathogenic bacteria identified in samples KK1, KK2, KK3, KK4 and KK5 were Escherichia coli, Pseudomonas sp. and Staphylococcus sp.

Sign in / Sign up

Export Citation Format

Share Document