scholarly journals Large Variations in Disease Severity, Death and ICU Admission of 2993 Patients Infected with SARS-CoV-2: The Potential Impact of Genetic Vulnerability

2021 ◽  
Author(s):  
Halah Mohammed Farajallah ◽  
Sara Khamis AlSuwaidi ◽  
Shatha Mohammad AlSuwaidi ◽  
Ghada AlAhmdani Al Ali ◽  
Amani Salem AlZubaidi ◽  
...  
Keyword(s):  
Disease Severity ◽  
Icu Admission ◽  
Genetic Vulnerability ◽  
Potential Impact

scholarly journals Incidence and Outcomes of Acute Kidney Injury in Patients Admitted to Hospital With COVID-19: A Retrospective Cohort Study

2021 ◽  
Vol 8 ◽  
pp. 205435812110277
Author(s):  
Tyler Pitre ◽  
Angela (Hong Tian) Dong ◽  
Aaron Jones ◽  
Jessica Kapralik ◽  
Sonya Cui ◽  
...  
Keyword(s):  
Mechanical Ventilation ◽  
Acute Kidney Injury ◽  
Cohort Study ◽  
Hospital Mortality ◽  
Disease Severity ◽  
Retrospective Cohort Study ◽  
Odds Ratio ◽  
Retrospective Cohort ◽  
Kidney Injury ◽  
Icu Admission

Background: The incidence of acute kidney injury (AKI) in patients with COVID-19 and its association with mortality and disease severity is understudied in the Canadian population. Objective: To determine the incidence of AKI in a cohort of patients with COVID-19 admitted to medicine and intensive care unit (ICU) wards, its association with in-hospital mortality, and disease severity. Our aim was to stratify these outcomes by out-of-hospital AKI and in-hospital AKI. Design: Retrospective cohort study from a registry of patients with COVID-19. Setting: Three community and 3 academic hospitals. Patients: A total of 815 patients admitted to hospital with COVID-19 between March 4, 2020, and April 23, 2021. Measurements: Stage of AKI, ICU admission, mechanical ventilation, and in-hospital mortality. Methods: We classified AKI by comparing highest to lowest recorded serum creatinine in hospital and staged AKI based on the Kidney Disease: Improving Global Outcomes (KDIGO) system. We calculated the unadjusted and adjusted odds ratio for the stage of AKI and the outcomes of ICU admission, mechanical ventilation, and in-hospital mortality. Results: Of the 815 patients registered, 439 (53.9%) developed AKI, 253 (57.6%) presented with AKI, and 186 (42.4%) developed AKI in-hospital. The odds of ICU admission, mechanical ventilation, and death increased as the AKI stage worsened. Stage 3 AKI that occurred during hospitalization increased the odds of death (odds ratio [OR] = 7.87 [4.35, 14.23]). Stage 3 AKI that occurred prior to hospitalization carried an increased odds of death (OR = 5.28 [2.60, 10.73]). Limitations: Observational study with small sample size limits precision of estimates. Lack of nonhospitalized patients with COVID-19 and hospitalized patients without COVID-19 as controls limits causal inferences. Conclusions: Acute kidney injury, whether it occurs prior to or after hospitalization, is associated with a high risk of poor outcomes in patients with COVID-19. Routine assessment of kidney function in patients with COVID-19 may improve risk stratification. Trial registration: The study was not registered on a publicly accessible registry because it did not involve any health care intervention on human participants.

scholarly journals Neopterin predicts disease severity in hospitalized patients with COVID-19

2020 ◽  
Author(s):  
Rosa Bellmann-Weiler ◽  
Lukas Lanser ◽  
Francesco Burkert ◽  
Stefanie Seiwald ◽  
Gernot Fritsche ◽  
...  
Keyword(s):  
Mechanical Ventilation ◽  
Retrospective Analysis ◽  
Disease Severity ◽  
Predictive Value ◽  
Clinical Management ◽  
Inflammatory Markers ◽  
Predictive Marker ◽  
Hospitalized Patients ◽  
Icu Admission ◽  
Circulating Inflammatory Markers

Abstract This study evaluates the predictive value of circulating inflammatory markers, especially neopterin, in patients with COVID-19. Within this retrospective analysis of 115 hospitalized COVID-19 patients, elevated neopterin levels upon admission were significantly associated with disease severity, risk for ICU admission, need for mechanical ventilation and death. Therefore, neopterin is a reliable predictive marker in patients with COVID-19 and may help to improve the clinical management of patients.

Intensive Care Admissions and Associated Severity of Influenza B Versus A During Influenza B Vaccine–mismatched Seasons

2019 ◽  
Vol 69 (6) ◽  
pp. 1049-1052 ◽  
Author(s):  
Maya Korem ◽  
Efrat Orenbuch-Harroch ◽  
Eli Ben-Chetrit ◽  
Sarah Israel ◽  
Matan J Cohen ◽  
...  
Keyword(s):  
Intensive Care Unit ◽  
Intensive Care ◽  
Disease Severity ◽  
Influenza B ◽  
Icu Patients ◽  
Icu Admission ◽  
Severe Influenza ◽  
Trivalent Vaccine ◽  
Quadrivalent Vaccines

Abstract Patients admitted to hospital with influenza B and A in Jerusalem, Israel, during the 2015–2016 and 2017–2018 influenza seasons demonstrated similar rates of intensive care unit (ICU) admission and associated disease severity. Most (63%) influenza B ICU patients received influenza B–mismatched trivalent vaccine. These findings call into question the equivalence of trivalent and quadrivalent vaccines in preventing severe influenza B.

scholarly journals 446. Prognostic Value of Absolute Lymphocyte Count for Disease Severity and Clinical Outcomes in Adult COVID-19 Inpatients

2021 ◽  
Vol 8 (Supplement_1) ◽  
pp. S324-S324
Author(s):  
Jianli Niu ◽  
Candice Sareli ◽  
Maria Deane ◽  
Aharon E Sareli
Keyword(s):  
Lactate Dehydrogenase ◽  
Clinical Outcomes ◽  
Disease Severity ◽  
Interleukin 6 ◽  
Lymphocyte Count ◽  
Absolute Lymphocyte Count ◽  
Serum Levels ◽  
C Reactive Protein ◽  
Icu Admission ◽  
Reactive Protein

Abstract Background Lymphopenia has been reported as a relatively frequent finding in patients with coronavirus disease 2019 (COVID-19). This study aimed to assess the use of absolute lymphocyte count (ALC) as a prognostic biomarker for disease severity and clinical outcomes. Methods A cohort of adult patients with COVID-19 admitted to Memorial Healthcare System, Hollywood, Florida from March 7, 2020 to January 18, 2021 was retrospectively analyzed. An absolute lymphocyte count (ALC) < 1.1 × 109/L was used as cutoff point to define lymphopenia. Correlations of ALC upon admission with age and serum levels of C-reactive protein, interleukin-6, lactate dehydrogenase, and creatinine were analyzed. Univariate and multivariate regression models were developed to assess the association of lymphopenia with the risk of ICU admission and clinical outcomes. Results 4,485 hospitalized patients were included in the final analyses. Median age was 61 (interquartile range, 47-73) years and 2,311 (51.5%) were men. Lymphopenia was more frequent in patients admitted to the ICU compared to those that were not admitted to the ICU, with an odds ratio of 2.14 (95% confidence interval [CI], 1.78-2.56, p < .0001) (Figure 1). The actual value of the ALC was negatively correlated with age and serum levels of C-reactive protein, interleukin-6, lactate dehydrogenase, and creatinine (all p < 0.005). Patients with lymphopenia (n=2,409) compared to those without lymphopenia (n=2,076) had multivariable-adjusted odds ratios of 1.85 (95% CI, 1.53-2.24) for ICU admission, 2.08 (95% CI, 1.67-2.58) for intubation, 1.98 (95% CI, 1.31-3.00) for development of acute kidney failure, and 2.23 (95% CI, 1.79-2.79) for in-hospital mortality (Table 1). Analyses were adjusted for age, gender, race, hypertension, diabetes, chronic obstructive pulmonary disease, chronic kidney disease, coronary artery disease, malignancy, obesity, and smoking. Conclusion Lymphopenia in adult COVID -19 hospitalized patients was associated with increased risk of disease severity (as evidenced by need for ICU admission) and poor clinical outcomes. Absolute lymphocyte count may help with prognostication in individuals hospitalized with COVID-19. Disclosures All Authors: No reported disclosures

scholarly journals Assessment of the HScore as a predictor of disease outcome in patients with COVID-19

2021 ◽  
Vol 21 (1) ◽  
Author(s):  
Mohammadreza Bordbar ◽  
Anahita Sanaei Dashti ◽  
Ali Amanati ◽  
Eslam Shorafa ◽  
Yasaman Mansoori ◽  
...  
Keyword(s):  
Disease Severity ◽  
Hospital Length ◽  
Hospital Length Of Stay ◽  
Multivariable Logistic Regression Analysis ◽  
Hospitalized Children ◽  
Icu Admission ◽  
Risk Of Death ◽  
Low Levels ◽  
Medical Wards ◽  
Secondary Hemophagocytic Lymphohistiocytosis

AbstractSevere coronavirus disease 2019 (COVID-19) accompanies hypercytokinemia, similar to secondary hemophagocytic lymphohistiocytosis (sHLH). We aimed to find if HScore could predict disease severity in COVID-19. HScore was calculated in hospitalized children and adult patients with a proven diagnosis of COVID-19. The need for intensive care unit (ICU), hospital length of stay (LOS), and in-hospital mortality were recorded. The median HScore was 43.0 (IQR 0.0–63.0), which was higher in those who needed ICU care (59.7, 95% CI 46.4–72.7) compared to those admitted to non-ICU medical wards (38.8, 95% CI 32.2–45.4; P = 0.003). It was also significantly higher in patients who died of COVID-19 (105.1, 95% CI 53.7–156.5) than individuals who survived (41.5, 95% CI 35.8–47.1; P = 0.005). Multivariable logistic regression analysis revealed that higher HScore was associated with a higher risk of ICU admission (adjusted OR = 4.93, 95% CI 1.5–16.17, P = 0.008). The risk of death increased by 20% for every ten units increase in HScore (adjusted OR 1.02, 95% CI 1.00–1.04, P = 0.009). Time to discharge was statistically longer in high HScore levels than low levels (HR = 0.41, 95% CI 0.24–0.69). HScore is much lower in patients with severe COVID-19 than sHLH. Higher HScore is associated with more ICU admission, more extended hospitalization, and a higher mortality rate. A modified HScore with a new cut-off seems more practical in predicting disease severity in patients with severe COVID-19.

scholarly journals Geriatric Intensive Care Unit Admission Protocol

2020 ◽  
Vol 3 ◽  
Author(s):  
Tom Byvoets ◽  
Brian Brewer
Keyword(s):  
Hospital Stay ◽  
Rib Fractures ◽  
Control Group ◽  
Supporting Evidence ◽  
Exact Test ◽  
Icu Admission ◽  
Icu Length Of Stay ◽  
Potential Impact ◽  
Discharge Criteria ◽  
Experimental Group

Background and Hypothesis:   The Society of Critical Care Medicine has recommended protocolized admission and discharge criteria for the ICU, but there is little supporting evidence for these guidelines. Our goal is to find predictors supported by data that can consistently triage patients appropriately on admission and decrease the need to upgrade the level of care during the same hospital stay. We hypothesized that applying a protocol would reduce the number of unplanned ICU admissions in our institution.    Methods:   We retrospectively applied our protocol to patients sixty-five years or older from the trauma registry at Methodist Hospital admitted between January 1 and December 31, 2019. Patients who did not have an unplanned ICU admission during hospital stay were used as the control group, while those who had an unplanned ICU admission event were considered the experimental group. After this, we used crosstabulation and Fisher’s exact test to analyze the data.    Results:   We reviewed one thousand one hundred forty-six (1146) subjects with 1088 in the control group and 58 in the experimental group. Subjects in the experimental group were statistically more likely to have COPD (OR: 2.646, p=0.001), been transfused > two units of PRBC in the first 24 hours (OR: 5.303, p=0.000), or to have greater than two rib fractures (OR: 2.469, p=0.002).     Conclusion and Potential Impact:   This study demonstrates that applying this protocol can capture elderly patients who will likely require ICU level care during their hospitalization. COPD, > two rib fractures, and transfusion of > two units PRBC during the first 24 hours appear to be significant predictors of clinical deterioration. Unplanned ICU admissions are associated with increased hospital and ICU length of stay. We must develop evidence-based protocols to decrease morbidity and cost associated with unplanned ICU admissions.  

scholarly journals Assessment and Modeling of COVID-19 Outcomes in a Longitudinal Cohort of Hospitalized Adults

2021 ◽  
Author(s):  
Lacy M Simons ◽  
Ramon Lorenzo-Redondo ◽  
Meg Gibson ◽  
Sarah L Kinch ◽  
Jacob P Vandervaart ◽  
...  
Keyword(s):  
Viral Load ◽  
Disease Severity ◽  
Antibody Titer ◽  
Neutrophil Count ◽  
Clinical Management ◽  
Lymphocyte Count ◽  
Hospitalized Patients ◽  
Viral Genotype ◽  
Icu Admission ◽  
Over Time

Background: While several demographic and clinical correlates of Coronavirus Disease 2019 (COVID-19) outcome have been identified, they remain imprecise tools for clinical management of disease. Furthermore, there are limited data on how these factors are associated with virological and immunological parameters over time. Methods and Findings: Nasopharyngeal swabs and blood samples were longitudinally collected from a cohort of 58 hospitalized adults with COVID-19 in Chicago, Illinois between March 27 and June 9, 2020. Samples were assessed for SARS-CoV-2 viral load, viral genotype, viral diversity, and antibody titer. Demographic and clinical information, including patient blood tests and several composite measures of disease severity, were extracted from electronic health records. All parameters were assessed for association with three patient outcome groups: discharge without intensive care unit (ICU) admission (n = 23), discharge with ICU admission (n = 29), and COVID-19 related death (n = 6). Higher age, male sex, and higher body mass index (BMI) were significantly associated with ICU admission. At hospital admission, higher 4C Mortality scores and lactate dehydrogenase (LDH) levels were likewise associated with ICU admission. Longitudinal trends in Deterioration Index (DI) score, Modified Early Warning Score (MEWS), and serum neutrophil count were also associated with ICU admission, though only the retrospectively calculated median DI score was predictive of death. While viral load and genotype were not significantly associated with outcome in this study, viral load did correlate positively with C-reactive protein levels and negatively with D-dimer, lymphocyte count, and antibody titer. Intra-host viral genetic diversity resulted in changes in viral genotype in some participants over time, though intra-host evolution was not associated with outcome. A stepwise-generated multivariable model including BMI, lymphocyte count at admission, and neutrophil count at admission was sufficient to predict outcome with a 0.82 accuracy rate in this cohort. Conclusions: These studies suggest that COVID-19 disease severity and poor outcomes among hospitalized patients are likely driven by dysfunctional host responses to infection and underlying co-morbid conditions rather than SARS-CoV-2 viral loads. Several parameters, including 4C mortality score, LDH levels, and DI score, were ultimately predictive of participant outcome and warrant further exploration in larger cohort studies for use in clinical management and risk assessment. Finally, the prevalence of intra-host diversity and viral evolution in hospitalized patients suggests a mechanism for population-level change, further emphasizing the need for effective antivirals to suppress viral replication and to avoid the emergence of new variants.

scholarly journals Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach

2017 ◽  
Vol 3 (1) ◽  
pp. 1
Author(s):  
Tania Tedjo Minuljo ◽  
Muhammad Hussein Gasem ◽  
Purnomo Hadi
Keyword(s):  
Disease Severity ◽  
Critically Ill ◽  
Immunocompetent Patient ◽  
Apache Ii ◽  
Apache Ii Score ◽  
Cmv Infection ◽  
Cross Sectional ◽  
Icu Admission ◽  
Qualitative Pcr ◽  
Hiv Aids

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.

scholarly journals Characterization of Microbial Co-infections in the Respiratory Tract of hospitalized COVID-19 patients

2020 ◽  
Author(s):  
Huanzi Zhong ◽  
Yanqun Wang ◽  
Zhun Shi ◽  
Lu Zhang ◽  
Huahui Ren ◽  
...  
Keyword(s):  
Respiratory Tract ◽  
Disease Severity ◽  
Burkholderia Cepacia ◽  
Secondary Infection ◽  
Science And Technology ◽  
Guangdong Province ◽  
Burkholderia Cepacia Complex ◽  
Microbial Composition ◽  
Icu Admission ◽  
Major Project

Summary Background Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused a global pandemic of Coronavirus disease 2019 (COVID-19). However, microbial composition of the respiratory tract and other infected tissues, as well as their possible pathogenic contributions to varying degrees of disease severity in COVID-19 patients remain unclear. Method Between January 27 and February 26, 2020, serial clinical specimens (sputum, nasal and throat swab, anal swab and feces) were collected from a cohort of hospitalized COVID-19 patients, including 8 mildly and 15 severely ill patients (requiring ICU admission and mechanical ventilation), in the Guangdong province, China. Total RNA was extracted and ultra-deep metatranscriptomic sequencing was performed in combination with laboratory diagnostic assays. Co-infection rates, the prevalence and abundance of microbial communities in these COVID-19 patients were determined. Findings Notably, respiratory microbial co-infections were exclusively found in 84.6% of severely ill patients (11/13), among which viral and bacterial co-infections were detected by sequencing in 30.8% (4/13) and 69.2% (9/13) of the patients, respectively. In addition, for 23.1% (3/13) of the patients, bacterial co-infections with Burkholderia cepacia complex (BCC) and Staphylococcus epidermidis were also confirmed by bacterial culture. Further, a time-dependent, secondary infection of B. cenocepacia with expressions of multiple virulence genes in one severely ill patient was demonstrated, which might be the primary cause of his disease deterioration and death one month after ICU admission. Interpretation Our findings identified distinct patterns of co-infections with SARS-CoV-2 and various respiratory pathogenic microbes in hospitalized COVID-19 patients in relation to disease severity. Detection and tracking of BCC-associated nosocomial infections are recommended to improve the pre-emptive treatment regimen and reduce fatal outcomes of hospitalized patients infected with SARS-CoV-2. Funding National Science and Technology Major Project of China, National Major Project for Control and Prevention of Infectious Disease in China, the emergency grants for prevention and control of SARS-CoV-2 of Ministry of Science and Technology and Guangdong province, Guangdong Provincial Key Laboratory of Genome Read and Write, Guangdong Provincial Academician Workstation of BGI Synthetic Genomics, and Shenzhen Engineering Laboratory for Innovative Molecular Diagnostics.

scholarly journals 411. Significance of a Known Epidemiological Link to a COVID-19 Index Case and Severity of COVID-19 Infection

2021 ◽  
Vol 8 (Supplement_1) ◽  
pp. S307-S307
Author(s):  
Christopher Kandel ◽  
Allison McGeer ◽  
Joshua Friedland ◽  
Altynay Shigayeva ◽  
Samira Mubareka
Keyword(s):  
Disease Severity ◽  
Primary Outcome ◽  
Viral Infections ◽  
Severity Of Illness ◽  
Exposure Dose ◽  
Community Dwelling ◽  
Next Of Kin ◽  
Multivariable Logistic Regression Model ◽  
Icu Admission ◽  
South Central

Abstract Background Several factors have been associated with severity of COVID-19 disease, but there remains a paucity of data surrounding whether the nature of exposure is impactful. Evidence demonstrating the correlation between initial viral exposure dose and disease severity exists for many viral infections. Observational studies have suggested that the exposure context, which can be considered a proxy for magnitude of viral inoculum, may influence severity of COVID-19 infection. We aimed to assess whether having a known exposure, as a proxy for higher inoculum dose to COVID-19, was associated with more severe outcomes for individuals hospitalized with COVID-19. Methods We created a retrospective cohort of community-dwelling adults hospitalized for COVID-19 in south-central Ontario from April 1, 2020 - January 14, 2021. Individuals or next of kin were contacted to ascertain exposure history. The primary outcome was death, intensive care unit (ICU) admission, or mechanical ventilation (MV) within 30 days of admission. A multivariable logistic regression model was used to determine whether a known exposure was associated with worse outcomes. Results 1097 individuals with community acquired COVID-19 required hospitalization; of these, 942 (86%) had available exposure data. In this group, the median age was 65, 44% were women, 84% lived in a private residence, 59% had a frailty score (FS) of 1 – 3 while 40% had a FS of 4 – 9, and 28% had a known exposure. Overall, the primary outcome occurred in 368/942 (39%) patients. Having a known exposure was not associated with worse outcome (OR 1.14, 95% CI 0.84–1.54, p = 0.41). Male gender (OR 1.41, 95% CI 1.06–1.89; p = 0.018), age (OR 1.01/year, 95% CI 1.00–1.03, p = 0.03), frailty (OR 1.22/point, 95% CI 1.09–1.36, p = 0.001) and living with at least one other person (OR 1.57, 95% CI 1.09–2.28, p = 0.017) were all associated with death, ICU admission, or MV within 30 days of admission. Conclusion While having a known exposure to a person with COVID-19 was not associated with worse outcome, the identified increased severity of illness associated with cohabitation suggests context of exposure may have a role in disease severity. This data and future studies can be used to guide public health recommendations to not only minimize transmission, but severity of COVID-19 infection. Disclosures All Authors: No reported disclosures

Sign in / Sign up

Export Citation Format

Share Document