Effects of Gene and Plasma Tau on Cognitive Impairment in Rural Chinese Population

Background: Sufficient attention was not paid to the effects of microtubule-associated protein tau (MAPT) and plasma tau protein on cognition. Objective: A total of 3072 people in rural China were recruited. They were provided with question-naires, and blood samples were obtained. Methods: The MMSE score was used to divide the population into cognitive impairment group and control group. First, logistic regression analysis was used to explore the possible factors influenc- ing cognitive function. Second, 1837 samples were selected for SNP detection through stratified sampling. Third, 288 samples were selected to test three plasma biomarkers (tau, phosphorylated tau, and Aβ-42). Results: For the MAPT rs242557, people with AG genotypes were 1.32 times more likely to devel- op cognitive impairment than those with AA genotypes, and people with GG genotypes were 1.47 times more likely to develop cognitive impairment than those with AG phenotypes. The plasma tau protein concentration was also increased in the population carrying G (P = 0.020). The plasma tau protein was negatively correlated with the MMSE score (P = 0.004). Conclusion: The mutation of MAPT rs242557 (A > G) increased the risk of cognitive impairment and the concentration of plasma tau protein.

Download Full-text

Study of cognitive impairment and genetic polymorphism of SLC41A1 (rs11240569 allele) in Parkinson’s disease in Upper Egypt: case-control study

The Egyptian Journal of Neurology Psychiatry and Neurosurgery ◽

10.1186/s41983-021-00341-0 ◽

2021 ◽

Vol 57 (1) ◽

Author(s):

Hamdy N. El-Tallawy ◽

Tahia H. Saleem ◽

Wafaa M. Farghaly ◽

Heba Mohamed Saad Eldien ◽

Ashraf Khodaery ◽

...

Keyword(s):

Parkinson’S Disease ◽

Parkinson's Disease ◽

Cognitive Impairment ◽

Case Control Study ◽

Case Control ◽

Control Group ◽

Motor Symptoms ◽

And Control ◽

Non Motor Symptoms ◽

Control Study

Abstract Background Parkinson’s disease is one of the neurodegenerative disorders that is caused by genetic and environmental factors or interaction between them. Solute carrier family 41 member 1 within the PARK16 locus has been reported to be associated with Parkinson’s disease. Cognitive impairment is one of the non-motor symptoms that is considered a challenge in Parkinson’s disease patients. This study aimed to investigate the association of rs11240569 polymorphism; a synonymous coding variant in SLC41A1 in Parkinson’s disease patients in addition to the assessment of cognitive impairment in those patients. Results In a case -control study, rs11240569 single nucleotide polymorphisms in SLC41A1, genes were genotyped in 48 Parkinson’s disease patients and 48 controls. Motor and non-motor performance in Parkinson's disease patients were assessed by using the Movement Disorder Society-Sponsored Revision of the Unified Parkinson’s Disease Rating Scale (MDS-UPDRS). The genotype and allele frequencies were compared between the two groups and revealed no significant differences between case and control groups for rs11240569 in SLC41A1 gene with P value .523 and .54, respectively. Cognition was evaluated and showed the mean ± standard deviation (SD) of WAIS score of PD patients 80.4 ± 9.13 and the range was from 61 to 105, in addition to MMSE that showed mean ± SD 21.96 ± 3.8. Conclusion Genetic testing of the present study showed that rs11240569 polymorphism of SLC41A1 gene has no significant differences in distributions of alleles and genotypes between cases and control group, in addition to cognitive impairment that is present in a large proportion of PD patients and in addition to the strong correlation between cognitive impairment and motor and non-motor symptoms progression.

Download Full-text

Salmonella Bacterin Vaccination Decreases Shedding and Colonization of Salmonella Typhimurium in Pigs

Microorganisms ◽

10.3390/microorganisms9061163 ◽

2021 ◽

Vol 9 (6) ◽

pp. 1163

Author(s):

Eduarda Alexandra Gonçalves de Oliveira Moura ◽

Daniela Gomes da Silva ◽

Caio Henrique Turco ◽

Thainara Vitoria Carnevalli Sanches ◽

Gabriel Yuri Storino ◽

...

Keyword(s):

Salmonella Typhimurium ◽

Blood Count ◽

Control Strategies ◽

Control Group ◽

Blood Samples ◽

Commercial Vaccine ◽

Serum Igg ◽

And Control ◽

Experimental Group ◽

Over Time

Since the occurrence of swine salmonellosis has increased over time and control strategies other than biosecurity are highly recommended, the present study aimed to evaluate the efficacy of vaccination with Salmonella Choleraesuis and Salmonella Typhimurium bacterins in pigs. Two experimental groups were formed: G1, animals immunized with two doses of a commercial vaccine (n = 20); G2, control group (n = 20). After vaccination, all pigs were orally challenged (D0) with 108 CFU of Salmonella Typhimurium and evaluated for 40 days. Every 10 days after D0, five piglets from each experimental group were euthanized and submitted to the necroscopic examination, when organ samples were collected. Blood samples and rectal swabs were collected before the first dose of the vaccine (D−42), before the second dose (D−21), before the challenge (D0), and thereafter, every three days until D39. Blood count, serum IgG measurement by ELISA, and the excretion of Salmonella Typhimurium in feces were evaluated. While the results from blood count and serum IgG concentration did not differ, the detection and excretion of Salmonella between G1 and G2 differed (p < 0.05). Therefore, it was observed that this vaccine partially protected the animals against experimental infection with Salmonella Typhimurium, reducing the excretion of bacteria in feces.

Download Full-text

Study of cognitive functions in major idiopathic interstitial pneumonias

Egyptian Journal of Bronchology ◽

10.1186/s43168-020-00046-7 ◽

2020 ◽

Vol 14 (1) ◽

Author(s):

Mohamed W. Zakaria ◽

Reem I. El-Korashy ◽

Mostafa O. Shaheen ◽

Samah Selim ◽

Kwashi J. Amum

Keyword(s):

Cognitive Impairment ◽

Cognitive Function ◽

Cognitive Dysfunction ◽

Mini Mental State Examination ◽

Mmse Score ◽

Control Group ◽

Healthy Individuals ◽

Co Morbidity ◽

Impaired Lung Function ◽

State Examination

Abstract Background Cognitive dysfunction in idiopathic interstitial pneumonia (IIP) is an important clinical co-morbidity that is associated with impaired lung function. The aim of the work is to assess cognitive function in major IIP and to find out the relation between cognitive dysfunction and the oxygenation parameters. Results Fifty individuals were involved in the study; 30 patients with major IIP and 20 healthy individuals. Patients with IIP had significantly lower mini mental state examination (MMSE) score compared to the control group (P < 0.001). Wechsler Deterioration Index (WDI) revealed that 33.3% (n = 10) of the patients with IIP had sure cognitive impairment and 26.6% (n = 8) had ongoing cognitive deterioration. Patients with idiopathic pulmonary fibrosis (IPF) had lower cognitive function than other IIP. Conclusion There is an impairment of cognitive function in patients with major IIP, particularly in IPF, as measured by WDI and MMSE. Further large studies are needed to assess the possible predictors of cognitive impairment and their effects on the patients’ outcome.

Download Full-text

A Study of Wideband Energy Reflectance in Patients with Otosclerosis: Data from a Chinese Population

BioMed Research International ◽

10.1155/2019/2070548 ◽

2019 ◽

Vol 2019 ◽

pp. 1-8 ◽

Cited By ~ 4

Author(s):

Suju Wang ◽

Wenyang Hao ◽

Chunxiao Xu ◽

Daofeng Ni ◽

Zhiqiang Gao ◽

...

Keyword(s):

Resonance Frequency ◽

Racial Differences ◽

Chinese Population ◽

Ambient Pressure ◽

Control Group ◽

Age And Gender ◽

Significant Difference ◽

And Gender ◽

And Control ◽

Peak Pressures

Objective(s). The purpose of this study was to explore the effectiveness of wideband acoustic immittance (WAI) in the diagnosis of otosclerosis by comparing the differences in the energy reflectance (ER) of WAI between patients with otosclerosis and age- and gender-matched normal hearing controls in the Chinese population. Methods. Twenty surgically confirmed otosclerotic ears were included in the otosclerotic group. The ER of WAI at ambient and peak pressures, resonance frequency, and 226-Hz tympanogram were collected prior to surgery using a Titan hearing test platform (Interacoustics A/S, Middelfart, Denmark). All diagnoses of otosclerosis in the tested ear were confirmed by surgery after the measurements. Thirteen normal adults (26 ears) who were age- and gender-matched with the otosclerotic patients were included as the control group. Results. At peak pressure, the ERs of otosclerotic patients were higher than those of the control group for frequencies less than 4,000Hz and were lower for frequencies greater than 4,000Hz. In addition, within the analyzed frequencies, the differences observed at 2,520Hz was statistically significant (p<0.05/16=0.003, Bonferroni corrected). At ambient pressure, the differences observed at 1,260 and 6,350Hz were statistically significant (p<0.05/16=0.003, Bonferroni corrected). Although the differences between the otosclerotic and control groups exhibited similar trends to those in studies implemented in Caucasian populations, the norms in the present study in the control group were different from those in the Caucasian populations, suggesting racial differences in WAI test results. Regarding the middle ear resonance frequency, no significant difference was observed between the two groups (P>0.05). Conclusion. WAI can provide valuable information for the diagnosis of otosclerosis in the Chinese population. Norms and diagnostic criteria corresponding to the patient’s racial group are necessary to improve the efficiency of WAI in the diagnosis of otosclerosis.

Download Full-text

Study the Oxidative Stress, Some Biochemical and Hematological Parameters in patients with agout at AL-Ramadi city

Baghdad Science Journal ◽

10.21123/bsj.13.4.694-701 ◽

2016 ◽

Vol 13 (4) ◽

pp. 694-701

Author(s):

Baghdad Science Journal

Keyword(s):

Blood Cells ◽

Hematological Parameters ◽

Age Groups ◽

Control Group ◽

Enzymatic Antioxidants ◽

Blood Picture ◽

Control Groups ◽

Blood Samples ◽

Normal Individuals ◽

And Control

This study aims to study the effect of gout disease on complete blood picture and biochemical parameters and some non-enzymatic antioxidants, some tracing elements and lipid peroxidation ,in outpatients with gout disease at Al-Ramadi Teaching-Hospital ,Al-Razi Hospital and the study duration from Octo.2013-to May 2014.(50) blood samples were collected from patients with age groups (30-80 years) from both sexes (28 males,22 females),a (30) blood samples (15 males,15 females) were collected from normal individuals as a control group with age groups (27-75 years). Hematological measurement showed no significant differences in size compressed blood cells, the percentages in ( 45.15 +4.99 and 46.87+6.30) % in patient and control groups respectively, hemoglobin concentrations were ( 14.04+1.66 and 14.30+1.93) g/l in patient and control groups respectively, total number of red blood cells ( 5.21+0.43 and 5.12 +0.58) 106/mm3 in patient and control groups respectively with(P?0.05) in ESR (21.06+13.47 and 13.37 +7.45) mm/hr in patient and control groups respectively with (P?0.05), the total number of WBCs were recorded (8.96+2.04 and 7.50+1.69)in patient and control groups respectively. Results showed also significant differences (P?0.05) in uric acid levels (7.42+0.76 and 5.62+0.88) mg/dl,malondialdehyde levels were recorded (4.45+0.64 and 3.21+0.86) in patient and control groups

Download Full-text

Herb-Drug Interaction: Effects of Relinqing® Granule on the Pharmacokinetics of Ciprofloxacin, Sulfamethoxazole, and Trimethoprim in Rats

Evidence-based Complementary and Alternative Medicine ◽

10.1155/2016/6194206 ◽

2016 ◽

Vol 2016 ◽

pp. 1-6 ◽

Cited By ~ 2

Author(s):

Yuan Lu ◽

ZiPeng Gong ◽

YuMin Xie ◽

Jie Pan ◽

Jia Sun ◽

...

Keyword(s):

Drug Interaction ◽

Pharmacokinetic Parameters ◽

Control Group ◽

Urinary System ◽

Blood Samples ◽

Sd Rats ◽

Chinese Patent ◽

Group 2 ◽

And Control ◽

Group 1

Relinqing granule (RLQ) is the best-selling Chinese patent drug for treatment of urinary system diseases. In this study, the effects of RLQ on the pharmacokinetics of ciprofloxacin, sulfamethoxazole, and trimethoprim in SD rats were investigated. Rats were randomly divided into control group 1, control group 2, RLQ group 1, and RLQ group 2. RLQ group 1 and RLQ group 2 were treated orally with RLQ for 7 days, and rats were treated with the same volume of water in control group 1 and control group 2. Then, RLQ group 1 and control group 1 were given intragastrically ciprofloxacin on day 8, while RLQ group 2 and control group 2 were given intragastrically sulfamethoxazole and trimethoprim on day 8. Blood samples were collected and determined. There was no significant influence of pharmacokinetic parameters of trimethoprim on two groups. But some pharmacokinetic parameters of ciprofloxacin and sulfamethoxazole in RLQ pretreated rats were evidently altered (P < 0.05), which indicated that absorption of ciprofloxacin and sulfamethoxazole in RLQ pretreated rats was significantly affected. It indicated the coadministration of RLQ would have an influence on the efficacy of ciprofloxacin and sulfamethoxazole, and the doses of ciprofloxacin tablet and compound sulfamethoxazole tablet need adjustment.

Download Full-text

Diagnostic Role Of MPV In Acute Appendicitis

10.46611/ajm-20204 ◽

2020 ◽

pp. 10-13

Author(s):

◽

Keyword(s):

Acute Appendicitis ◽

Mean Platelet Volume ◽

Pathological Diagnosis ◽

Control Group ◽

Healthy Children ◽

Platelet Volume ◽

Blood Samples ◽

Diagnostic Role ◽

And Control

Introduction: The aim of this study was to investigate the diagnostic role of mean platelet volume (MPV) for acute appendicitis. Methods: Patient files were retrospectively observed. MPV of 311 patients with pathological diagnosis of acute appendicitis were compared with the MPV of 314 healthy children (blood samples were taken for elective operations). SPSS (IBM SPSS Statistics for Windows, Version 20.0. Armonk, NY: IBM Corp.) was used to evaluate the results. Results: 188 of acute appendicitis were male (%60.5). Mean age of acute appendicitis group was 10.22±3.83. MPV of children with the diagnosis of acute appendicitis (8.37±0.83fL) and the control group (10.55±0.83fL). MPV values were statistically different between the acute appendicitis and control group (p<0,001). Conclusion: MPV may be used as a marker for the diagnosis of acute appendicitis, but it is not a specific biomarker for appendicitis.

Download Full-text

Interferon Gamma +874A/T Polymorphism in Children with Idiopathic Thrombocytopenic Purpura

Blood ◽

10.1182/blood.v112.11.4539.4539 ◽

2008 ◽

Vol 112 (11) ◽

pp. 4539-4539

Author(s):

Fatih Demircioglu ◽

Hale Ören ◽

Sefa Kizildag ◽

Sebnem Yilmaz ◽

Berna Atabay ◽

...

Keyword(s):

Allele Frequency ◽

Interferon Gamma ◽

Gene Polymorphisms ◽

Statistical Difference ◽

Control Group ◽

Blood Samples ◽

Chronic Itp ◽

Significant Difference ◽

Acute Itp ◽

And Control

Abstract A recent study showed that expression of Toll-like receptor and interferon-gamma associated genes is significantly increased in patients with chronic ITP. Interferon-gamma is an important protein which takes place in immunoregulation. +874A/T polymorphism in the first introne of interferon gamma gene is found to be associated with the development and clinical phenotype of some autoimmune diseases such as diabetes mellitus, thyroiditis, multiple sclerosis, and SLE. The aim of our study was to investigate whether interferon gamma +874A/T polymorphism is a risk factor for the development of ITP and whether it affects the clinical course and response to the treatment. Thirty five children with acute ITP and 40 children with chronic ITP who were followed for at least 6 months were included. Control group consisted 90 healthy children. Two millilitres of blood sample was taken into sterile tubes containing 0.1% EDTA from each child and all blood samples were stored at −20 until analysis. DNA was isolated from blood samples and interferon gamma +874A/T polymorphism was studied with real-time PCR and LightCycler TM. Twenty one patients had AA, 35 patients had AT, and 19 patients had TT genotype. In the control group, 47 children had AA, 36 children had AT, and 7 children had TT genotype. There was a statistical difference between ITP and control group regarding the genotype (p=0.001). The frequency of A and T alleles in ITP group was 52% and 48%, respectively. The frequency of A and T alleles in control group was 72.7% and 27.8%, respectively. The frequency of allele distribution was statistically different between the ITP and control groups (p<0.0001). There was a statistical significant difference between acute ITP and control group regarding the frequency of AA, AT, and TT gene polymorphisms and allele frequency (p=0.002, p=0.002). Similarly, there was a statistical significant difference between chronic ITP and control group regarding the frequency of AA, AT, and TT gene polymorphisms and allele frequency (p=0.008, p=0.002). The frequency of AA, AT, and TT gene polymorphisms and allele frequency showed no statistical difference between acute and chronic ITP groups (p=0.285, p=0.896). There was no correlation between interferon gamma +874A/T polymorphism and severity of bleeding (mild, moderate and severe) (p=0.09). There was no correlation between interferon gamma +874A/T polymorphism and response to long term treatment in patients with chronic ITP (p=0.568). In conclusion, there was a significant difference between patients with ITP and children in control group regarding interferon gamma +874A/T polymorphism and in the light of recent data involving other autoimmune disorders, we think that interferon gamma +874A/T polymorphism may be a risk factor for ITP.

Download Full-text

Comparative Study of Vitamin C on Serum Lipid Profile in Healthy Male and Female Human Subjects

Journal of Scientific Research ◽

10.3329/jsr.v4i3.8894 ◽

2012 ◽

Vol 4 (3) ◽

pp. 775-781 ◽

Cited By ~ 2

Author(s):

G. S. Gaur ◽

A. K. Dixit

Keyword(s):

Vitamin C ◽

Lipid Profile ◽

Ldl Cholesterol ◽

Human Subjects ◽

Test Group ◽

Control Group ◽

Blood Samples ◽

Male And Female ◽

Vitamin C Supplementation ◽

And Control

This study aims to assess the comparative effects of vitamin C supplementation on lipid profiles in male and female human subjects. A total of 60 healthy individuals (male and female) were selected randomly, instructed and given the understanding of the purpose of study. The test group comprising 30 individuals were given 500mg vitamin C tablets one daily for 30 days and control group of 30 individuals were given placebo capsules(glucose 500mg) one daily for 30 days. Fasting blood samples were collected in the morning for estimation of cholesterol, triglycerides, HDL-C, LDL-C and VLDL-C on first day of the commencement of the study and second blood samples were taken after thirty days of supplementation and same estimations were carried out. Vitamin C caused reduction in serum total cholesterol and LDL cholesterol significantly but it did not have any statistically significant effect on HDL-C, VLDL-C and triglycerides. As far as gender is concerned the effect of vitamin C on lipid profile in males was not significantly different from those in females.© 2012 JSR Publications. ISSN: 2070-0237 (Print); 2070-0245 (Online). All rights reserved.doi: http://dx.doi.org/10.3329/jsr.v4i3.8894 J. Sci. Res. 4 (3), 775-781 (2012)

Download Full-text

Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride

BIO Web of Conferences ◽

10.1051/bioconf/20214106003 ◽

2021 ◽

Vol 41 ◽

pp. 06003

Author(s):

Lu’lu’ Sahara Wusahaningtyas ◽

Moh Mirza Nuryady ◽

Lintang Winantya Firdausy ◽

Ahmad Fahrurrozi Zs ◽

R. Wisnu Nurcahyo

Keyword(s):

Amino Acids ◽

Amino Acid ◽

Abc Transporters ◽

Trypanosoma Evansi ◽

Control Group ◽

Transporter Gene ◽

High Similarity ◽

Blood Samples ◽

Multiple Alignments ◽

And Control

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.

Download Full-text